Отраслевая сеть инноваций в АПК

МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ​

Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Титульный лист и исполнители

РЕФЕРАТ

Отчет на 89 страницах, содержит 50 рисунков, 10 таблиц,56 литературных источников, и 4 приложения.

Ключевые слова: ГЕНОТИП, ФЕНОТИП, АЛЛЕЛЬ, МОЛОЧНАЯ ПРОДУКТИВНОСТЬ, ДИАЦИЛГЛИЦЕРИН-O-АЦИЛТРАНСФЕРАЗА 1, ЛЕПТИН, РЕЦЕПТОР ГОРМОНА РОСТА, K-КАЗЕИН, Β-ЛАКТОГЛОБУЛИН,

Объектом исследования являются коровы черно-пестрой породы Свердловской области.

Цель работы – провести генотипирование и фенотипирование в популяции крупного рогатого скота Свердловской области по генам, ассоциированным с продуктивностью. Создание и формирование геномной базы популяции крупного рогатого скота Свердловской области для развития научной деятельности и получения в дальнейшем племенного поголовья животных с заданными характеристиками по продуктивности, качеству получаемой продукции, здоровью и долголетию.

Генотипирование проводили на биочипах GGP Bovine 150K, разработанных Illumina совместно с Neogen и методом ПЦР-ПДРФ

В результате исследования 2020 года получены следующие результаты:

1. Впервые проведенное на маточном поголовье крупного рогатого скота генотипирование по генам продуктивности, ассоциирована с фенотипическим проявлением.

2. Установлено достоверное влияние на продуктивность генов LEP, GHR, DGAT1, CSN_AB. Корреляционная зависимость установлена для дуплетного влияния пары генов GHR-LEP в однородности показателя удоя, а для варианта BB-AA, значение выше (наибольшие средние), что соответствует гипотезе о синергичном воздействии генов.

3. Разработана тест-система для генотипирования в режиме real-time по генам LEP и GHR.

4. Рекомендованы наиболее эффективные генотипы, обеспечивающие получение дополнительного дохода от 6154 рублей до 34586 рублей в год с племенной коровы.

Результаты исследования представлены к публикации в журнал «IOPConferenceSeries: EarthandEnvironmentalScience» (Scopus), журнал «Известия Оренбургского ГАУ»(перечень ВАК).

ВВЕДЕНИЕ

Современные условия ведения селекционной работы диктуют проведения отбора животных не только по фенотипическим признакам, а по сочетанному эффекту генотипа и паратипа на фенотип.

До внедрения геномных исследований влияние генотипа рассматривалось исключительно по принадлежности животного к генеалогической линии. Такие исследования проводились на протяжении долгих лет. Были выявлены различные закономерности влияния линейной принадлежности. По данным отечественных ученых, проведенных в разных регионах страны, не было выявлено приоритетного превосходства какой-либо генеалогической линии [1- 4]. В зависимости от условий хозяйства проявляли себя быки разных линий как улучшающие удой, жиро- и белково-молочность [5-7]. Все приведенные данные свидетельствуют о том, что каждая из генеалогических линий имеет в себе как выдающихся представителей, так и совершенно посредственных, либо попавших в не соответствующие условия для раскрытия своего потенциала [8,9].

Первые попытки генотипирования крупного рогатого скота по генам продуктивности проводили с помощью ПЦР [10-13]. Это достаточно трудозатратная методика, особенно если цель работы выявление нескольких полиморфизмов. Сегодня технологии ДНК-чипов и genome-wide association study (GWAS) во многом упростили задачу выявления генов, играющих важную роль в проявлении признака [14-16]. Фермент диацилглицерин-O-ацилтрансфераза 1 (ДГАТ1 или DGAT1) связан с составом молока и удоем [17,18]. Лептин (LEP) имеет широкое влияние на метаболизм, потребление и усвоение пищи, рост и массу тела [19-21]. Маркер лептина Exon 2FB позволяет также определить гомо- и гетерозиготные аллельные формы, связанные с перинатальной смертностью телок [22]. Ген рецептора гормона роста (GHR) также влияет на рост и метаболизм [23, 24], а его маркер ARS-BFGL-NGS-118998 связан с некоторыми показателями молочной продуктивности [17, 24]. Два важных белковых компонента молока k-казеин и β-лактоглобулин кодируются соответственно CSN_AB и LGB генами. Они являются определяющими при оценке молочной продуктивности [26]. Вариант BB гена β-лактоглобулин связан с более низкой концентрацией его белкового продукта [27, 28], что делает его желательным поскольку β-лактоглобулин основной аллерген молока [29, 30]. Вариант B k-казеина ассоциирован с более высокой долей белка в молоке по сравнению с A аллелем [27].

Цель исследования – Генотипирование и фенотипирование популяции крупного рогатого скота Свердловской области по генам, ассоциированным по генам продуктивности; – Создание и формирование геномной базы популяции крупного рогатого скота Свердловской области для развития научной деятельности и получения в дальнейшем племенного поголовья с заданными характеристиками по продуктивности, качеству получаемой продукции, здоровью и долголетию.

Задачи:

1. Провести оценку зоотехнических показателей молочной продуктивности крупного рогатого скота: живая масса, удой, содержание белка и жира.

2. Провести геномную оценку маточного поголовья уральского скота.

3. Выявить корреляционные зависимости генотипа с фенотипом.

1. ГЕНЫ, АССОЦИИРОВАННЫЕ С МОЛОЧНОЙ ПРОДУКТИВНОСТЬЮ КРУПНОГО РОГАТОГО СКОТА

Практика генотипирования показала, что ряд генов ассоциирован с молочной продуктивностью крупного рогатого скота, несмотря на полигенное наследование, а также значимое влияние паратипических факторов.

Ген – CSN3. Всего идентифицировано 11 аллелей гена каппа-казеин. CSN3 – один из немногих известных генов,однозначно связанных с признаками белковомолочности итехнологическими свойствами молока. В-аллель гена каппа-казеина ассоциирован с более высоким выходом творога и сыра, а также с лучшими коагуляционнымисвойствами молока [31]. Каппа-казеин кодируется геном CSN3, в котором обнаружены значимые для молочной продуктивности замены: rs43703015 (g.88532296C>T; Thr136Ile), rs43703016 (g.88532332A>C; Asp148Ala) [32]. Однонуклеотидная замена rs43703015, определяющая генотип B, связанная с повышенным содержанием жира и лактозы, уменьшает остальные белковые показатели. [33]. Этот результат согласуется с другими исследованиями, в которых также сообщается об уменьшении удоя [34] или отсутствии значительной ассоциации данного варианта с показателями качества молока. Показано, что аллель А по замене rs43703015 отрицательно влияет на коагуляционные свойства молока, так как увеличивает время сычужной коагуляции белков и уменьшает показатель плотности творожного сгустка спустя 30 мин после добавления фермента [35].

Практика показывает, что высококачественные твердые сыры могут быть изготовлены только из молока, полученного от коров, имеющих генотип ВВ каппа-казеина. В некоторых случаях для решения селекционных и научных задач требуется более детальное изучения этого гена.

Ген – LGВ. β-Лактоглобулин является основным белком молочной сыворотки. Несмотря на то, что лактоглобулины не участвуют в процессе коагуляции молока, различные полиморфные варианты гена LGB, кодирующего β-лактоглобулин, оказывают влияние на свертываемость молока [36]. Ген LGB находится на 11 хромосоме; для него описано 11 полиморфных вариантов [37]. Но однонуклеотидная замена rs110066229 (g.107168524A>G) наиболее значима и распространена у молочного скота. Она приводит к замещению аспарагиновой кислоты глицином в кодоне 64. Замена влияет на удой, а также на содержание жира и белка в молоке [38].

Ген GHR. На хромосоме 20 обнаружена мутация GHR (рецептора гормона роста), которая оказывает большое влияние на удой и состав молока. Было обнаружено, что однонуклеотидный полиморфизм ARS-BFGL-NGS-118998, который расположен точно в этом гене, оказывает большое влияние на процентное содержание жира, но не обнаружено влияние на увеличение удоя.[17]

Полиморфный вариант, влияющий на молочную продуктивность крупного рогатого скота, был обнаружен и в гене рецептора гормона роста (GHR) [39]. Однонуклеотидная замена T на А в экзоне 8, приводящая к изменению аминокислотного остатка в позиции 279 (Phe279Tyr), приводит к увеличению суточного удоя [40].

Ген DGAT. Получены данные, что SNP ARS-BFGL-NGS-499, расположенный в DGAT1 на хромосоме 14, оказывает наибольшее влияние на все показатели молочной продуктивности. Многими исследованиями доказано, что мутация в DGAT1, влияет на различия в признаках молочной продуктивности [17]. В большей степени он положительно влияет на выход жира и отрицательно на удой молока и содержание белка [41]

Ген LEP. Лептин кодируется геном LEP и выделяется в кровь адипоцитами белой жировой ткани. Лептин связывается с рецептором в головном мозге и выполняет эндокринную функцию. Белок играет важную роль в гомеостазе и регуляции энергетического обмена, иммунных реакций, гемопоэза. Для данного гена было отмечено, что однонуклеотидная замена A>T в 252 положении связана со снижением удоя молока [21].

1.1 Материал и методы исследования. Исследования проводили в четырех племенных организациях Свердловской области: ЗАО “Новопышминское”, ООО “Бородулинское” – племенные заводы; ОАО “Учхоз “Уралец”, ООО Агропромышленная фирма “Луч” – племенные репродукторы.

Для выявления значимого влияния генотипа на фенотипическое проявление признака были отобраны хозяйства с одинаковой технологией содержания и доения коров, но с достоверной разницей между группами отобранных животных для генотипирования по продуктивным качествам. В группы животных для геномного исследования были отобраны наиболее старые особи (2007-2013 годов рождения) в количестве 48 (генотипированных на чипах) и 24 головы (генотипированных методом ПЦР), что составило от 5 до 10,0 % от поголовья каждой из сельскохозяйственных организаций. Всего было проанализировано 288 голов, на чипах – 192 головы и методом ПЦР-ПДРФ – 96.

Генотипирование проводили на биочипах GGP Bovine 150K, разработанных Illumina совместно с Neogen, в Центре коллективного пользования научным оборудованием «Биоресурсы и биоинженерия сельскохозяйственных животных» на базе Государственного Всероссийского научно-исследовательского института животноводства имени академика Л.К. Эрнста и методом ПЦР-ПДРФ (полимеразной цепной реакции и полиморфизма длин рестрикционных фрагментов) в лаборатории молекулярных и биологических исследований ФГБОУ ВО Уральский ГАУ.

Материалом для исследования служила кровь, пробы отбирали из подхвостовой вены в вакуумные пробирки с антикоагулянтом ЭДТА К3.

ДНК выделяли с помощью набора реагентов ООО “НПФ “Синтол” ДНК-Экстран-1.

Качество выделенной ДНК проверяли на наноспектрофотометре Nabi UV/Vis NANO сразу после выделения.

Были проведены соответствия между маркерами на чипах и методом ПЦР-ПДРФ для генов каппа-казеина (CSN_AB), лептина (LEP), бета-лактоглобулина (LGB) и рецептора соматотропина (GHR). Результаты ПЦР-ПДРФ включили в анализ данных совместно с полученными путём генотипирования на чипах. Праймеры используемые в работе и соответствующие рестриктазы представлены в таблице 1.

Таблица 1 – Праймеры и рестриктазы, используемые в работе

Ген Праймеры Рестриктаза Статья
CSN_AB F: ATCATTTATGGCCATTCCACCAAAG HinfI [26]
R: GCCCATTTCGCCTTCTCTGTAACAGA
LEP F: GGGAAGGGCAGAAAGATAG HphI [42]
R: CCAAGCTCTCCAAGCTCTC
LGB F: TGTGCTGGACACCGACTACAAAAAG HaeIII [26]
R: GCTCCCGGTATATGACCACCCTCT
GHR F: GCTAACTTCATCGTGGACAAC AluI [43]
R: CTATGGCATGATTTTGTTCAG

Электрофорез проводили в горизонтальных камерах на 2% агарозном геле в TAE-буфере при 150 вольтах в течение 50 минут.

Генотипирование по гену CSN_AB методом ПЦР. Реакционная смесь для ПЦР, объёмом 20 мкл состояла из: 2 мкл буфера для Taq-полимеразы, 2 мкл dNTP, 2 мкл MgCl2, по 0,4 мкл прямого и обратного праймеров, 0,4 Taq-полимеразы; 8,8 мкл воды для ПЦР и 4 мкл ДНК.

Условия проведения ПЦР:

95°C 5 мин.
95°C 30 сек. 35 циклов
57°C 1 мин.
72°C 30 сек.
72°C 10 мин.

В результате полученный ПЦР-продукт длинной 350 нуклеотидных пар (нп) в объёме 12 мкл вносили в заранее подготовленную рестрикционную смесь. Смесь состояла из 2,5 мкл буфера для рестрикции, 0,3 мкл рестриктазы HinfI и 10,2 мкл воды. После 16 часов рестрикции при 37°C, разгоняли полученные фрагменты в 2% агарозном геле (рисунок 1). Доминантной гомозиготе AA принадлежат фрагменты длинной 134, 132 (выглядят, как один бенд) и 84 нп, рецессивной гомозиготе BB – 266 и 84 нп, гетерозигота AB имеет фрагменты всех длин.

word image Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 1 – Результаты ПЦР-ПДРФ анализа гена CSN_AB.

Генотипирование по гену LEP методом ПЦР. Реакционная смесь для ПЦР, объёмом 20 мкл состояла из: 2 мкл буфера для Taq-полимеразы, 2 мкл dNTP, 2 мкл MgCl2, по 0,4 мкл прямого и обратного праймеров, 0,4 Taq-полимеразы; 8,8 мкл воды для ПЦР и 4 мкл ДНК.

Условия проведения ПЦР:

95°C 5 мин.
95°C 30 сек. 30 циклов
57°C 1 мин.
72°C 30 сек.
72°C 10 мин.

В результате полученный ПЦР-продукт длинной 458 нп в объёме 12 мкл вносили в заранее подготовленную рестрикционную смесь. Смесь состояла из 2,5 мкл буфера для рестрикции, 0,3 мкл рестриктазы HphI и 10,2 мкл воды. После 16 часов рестрикции при 37 °C, разгоняли полученные фрагменты в 2% агарозном геле (рисунок 2). Неразрезанный фрагмент длинной 458 нп соответствует генотипу AA, 458, 311 и 147 нп – генотипу AB и генотипу BB – 311, 147 нп.

word image 1 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 2– Результаты ПЦР-ПДРФ анализа гена LEP.

Генотипирование по гену LGB методом ПЦР. Реакционная смесь для ПЦР, объёмом 20 мкл состояла из: 2 мкл буфера для Taq-полимеразы, 2 мкл dNTP, 2 мкл MgCl2, по 0,4 мкл прямого и обратного праймеров, 0,4 Taq-полимеразы; 8,8 мкл воды для ПЦР и 4 мкл ДНК.

Условия проведения ПЦР:

95°C 5 мин.
95°C 1 мин. 35 циклов
56°C 45 сек.
72°C 1 мин.
72°C 10 мин.

В результате полученный ПЦР-продукт длинной 247 нп в объёме 12 мкл вносили в заранее подготовленную рестрикционную смесь. Смесь состояла из 2,5 мкл буфера для рестрикции, 0,3 мкл рестриктазы HaeIII и 10,2 мкл воды. После 16 часов рестрикции при 37 °C, разгоняли полученные фрагменты в 2% агарозном геле (рисунок 3). Генотипу AA соответствуют фрагменты 148 и 99 нп, генотипу BB фрагмент 99 и два фрагмента 74 нп (наблюдаются как один бенд), гетерозигота определяется при обнаружении фрагментов 148, 99, 74 и 74.

Изображение выглядит как здание Автоматически созданное описание

Рисунок 3 – Результаты ПЦР-ПДРФ анализа гена LGB.

Генотипирование по гену GHR методом ПЦР. Реакционная смесь для ПЦР, объёмом 20 мкл состояла из: 2 мкл буфера для Taq-полимеразы, 2 мкл dNTP, 2 мкл MgCl2, по 0,4 мкл прямого и обратного праймеров, 0,4 Taq-полимеразы; 8,8 мкл воды для ПЦР и 4 мкл ДНК.

Условия проведения ПЦР:

95°C 5 мин.
95°C 45 сек. 35 циклов
50°C 30 сек.
72°C 50 сек.
72°C 10 мин.

В результате полученный ПЦР-продукт длинной 342 нп в объёме 12 мкл вносили в заранее подготовленную рестрикционную смесь. Смесь состояла из 2,5 мкл буфера для рестрикции, 0,3 мкл рестриктазы AluI и 10,2 мкл воды. После 16 часов рестрикции при 37 °C, разгоняли полученные фрагменты в 2% агарозном геле (рисунок 4). Фрагменты длины 191, 101 и 50 нп соответствуют генотипу AA, фрагменты 191, 151, 101, и 50 – AB и генотипу BB – 191 и 151.

word image 2 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 4 – Результаты ПЦР-ПДРФ анализа гена GHR.

Данными для сравнения служила база ИАС “СЕЛЭКС-Молочный скот”.

Полученные данные анализировали с помощью пакета для языка R stats [44]. Визуализировали полученные результаты в среде R с помощью пакетов graphics и ggplot2 [45] и Excel.

2. ФЕНОТИПИЧЕСКОЕ ОПИСАНИЕ ИССЛЕДУЕМОГО ПОГОЛОВЬЯ

Данные выборки были нормально распределены (p>0,01) для следующих показателей: удой за первую и третью лактации; массовая доля жира и белка за первую и третью лактации; выход молочного жира и белка за первую и третью лактации; пожизненные показатели: удоя, выхода молочного жира и белка; живая масса первой и третьей лактации. Для проверки на нормальность использовали модифицированный критерий Колмогорова-Смирнова (критерий Лиллифорса). Показатели массовой доли жира и белка, а также пожизненного удоя и живой массы при первой лактации не соответствовали нормальному распределению и влияние факторов на этот показатель оценивали непараметрическими методами.

Чтобы исключить другие факторы и достоверно оценить связь среды и/или генотипа на хозяйственные показатели в исследуемой выборке, мы проверили влияние года рождения животного и его кровности, предварительно избавившись от выбросов. Всего было генотипировано 288 коров 2007-2013 годов рождения. Для каждого отдельного хозяйства доля коров 2011-2013 годов рождения составила свыше 69,7%. Общая доля этих животных в данных составила 82,4%. В силу слишком маленькой (от 1 до 18 голов) подвыборки наиболее старых коров (2007-2010 годов рождения) полученные результаты трудно интерпретируемы. Подобная же ситуация была выявлена и в ходе проверки гипотезы о влиянии кровности на хозяйственно полезные признаки. Так в хозяйстве ООО “Новопышминское” 93,2% особей приходится на группу кровности 88-100, в то время как в других хозяйствах этот показатель не превышает 20%.

Была показана значительная разница между хозяйствами, как средовым фактором, который существенно влияет на молочную продуктивность. За исключением возраста в лактациях и доли белка по третьей лактации, все показатели были статистически значимо различны (P<0,05). ООО “Новопышминское” лидирует по показателям удоя и со связанными с ним массами жира и белка. При этом доли жира за обе лактации были выше в OOO “Бородулинское”, как и живая масса при обеих лактациях. По показателям удоя и массам белка и жира OOO “Бородулинское” занимает промежуточное положение между ООО “Новопышминское” и остальными хозяйствами. А показатели доли белка первой лактации OOO “Бородулинское” и ООО “Новопышминское” значимо выше ОАО “Учхоз Уралец”. ООО “Агропромышленная фирма “Луч”” и ОАО “Учхоз Уралец” оказались статистически неразличимы по большинству признаков. Наиболее широкий разброс данных по показателям был в ООО “Агропромышленной фирме “Луч””. Оценка массы тела коров была проведена только для OOO “Бородулинское”, ОАО “Учхоз Уралец” и ООО “Агропромышленная фирма “Луч””. Полученные нами данные массы тела за первую и третью лактации показывают значительный отрыв OOO “Бородулинское” от других хозяйств (рисунок 5, 6, 7).

word image Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 5 – Распределение показателей продуктивности внутри хозяйств. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

word image 1 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 6 – Распределение показателей продуктивности внутри хозяйств. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

word image 2 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 7 – Распределение показателей продуктивности внутри хозяйств. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

3. ГЕНОТИПИЧЕСКОЕ ОПИСАНИЕ ИССЛЕДОВАННОГО ПОГОЛОВЬЯ

В первую очередь был проведен анализ частоты генотипов методом χ2 для определения отклонений наблюдаемых значений от ожидаемых (таблица 2). Такой же анализ был проведён для каждого отдельного хозяйства. Всего было исследовано 288 голов (по 72 из каждого хозяйства) по генам каппа-казеина (CSN_AB), рецептора гормона роста (GHR), бета-лактоглобулина (LGB) и лептина (LEP); по гену диацилглицерин-O-ацилтрансфераза 1 (DGAT1) анализировали данные 192 голов.

В целом наблюдается высокая доля гомозиготных особей с формой аллеля A по гену каппа-казеина. Гомозиготны по данному варианту гена CSN_AB 67% особей, а внутри хозяйств его частота может составлять до 86%. Подобное смещение в пользу доминантных гомозигот является следствием отбора на высокие показатели удоя, что мы можем понять по значимому отклонению наблюдаемых генотипов от ожидаемых. Значимые отклонения от ожидаемого распределения также наблюдаются для генов GHR и LGB. По гену GHR больше всего в популяции доминантных особей AA (41%), в то время как по гену LGB преобладают гетерозиготы AB (56%). Преобладающие генотипы гена лептина AB и гена DGAT1 AA с 47% и 45% соответственно. Отклонений от ожидаемого распределение частот аллелей и генотипов по генам DGAT1 и LEP не обнаружено.

При определении частот генотипов отдельных хозяйств значимые отклонения от ожидаемого распределения выявлены только в ООО “Новопышминское” для генов GHR и LEP и в ООО “Агропромышленная фирма “Луч”” для гена CSN_AB. При этом доля рецессивных гомозигот гена GHR в ООО “Новопышминское” в три раза выше, чем в среднем по другим хозяйствам, а доля гетерозигот по LEP выше более чем в полтора раза.

Таблица 2 – Генотипическое состоянии исследованного поголовья голштинизированного чёрно-пёстрого скота Свердловской области

Ген Наблюдаемые генотипы Наблюдаемые частоты аллелей Ожидаемые генотипы Ожидаемые частоты аллелей χ2 p
AA AB BB A B AA AB BB A B
1 2 3 4 5 6 7 8 9 10 11 12 13
Все организации
GHR* 41,7 37,8 20,5 0,61 0,39 29,9 49,7 20,5 0,55 0,45 21,53 0,00
CSN_AB* 67,7 25,3 6,9 0,80 0,20 54,2 38,9 6,9 0,74 0,26 23,33 0,00
LEP 16,7 47,2 36,1 0,40 0,60 16,0 47,9 36,1 0,40 0,60 0,12 0,94
DGAT1 44,8 44,3 10,9 0,67 0,33 44,8 44,3 10,9 0,67 0,33 0,00 1,00
LGB* 24,3 56,6 19,1 0,53 0,47 31,6 49,3 19,1 0,56 0,44 7,95 0,02
ООО “Новопышминское”
GHR* 34,7 25,0 40,3 0,47 0,53 13,9 45,8 40,3 0,37 0,63 29,318 0,000
CSN_AB 44,4 43,1 12,5 0,66 0,34 41,7 45,8 12,5 0,65 0,35 0,255 0,880
LEP* 20,8 65,3 13,9 0,53 0,47 38,9 47,2 13,9 0,63 0,37 11,006 0,004
DGAT1 41,7 39,6 18,8 0,61 0,39 31,3 50,0 18,8 0,57 0,43 2,708 0,258
LGB 23,6 58,3 18,1 0,53 0,47 33,3 48,6 18,1 0,58 0,42 3,442 0,179
OOO “Бородулинское”
GHR 50,0 34,7 15,3 0,67 0,33 37,5 47,2 15,3 0,61 0,39 5,382 0,068
CSN_AB 59,7 31,9 8,3 0,76 0,24 50,0 41,7 8,3 0,71 0,29 2,994 0,224
LEP 20,8 43,1 36,1 0,42 0,58 15,3 48,6 36,1 0,40 0,60 1,912 0,384
DGAT1 31,3 56,3 12,5 0,59 0,41 41,7 45,8 12,5 0,65 0,35 2,386 0,303
LGB 20,8 56,9 22,2 0,49 0,51 27,8 50,0 22,2 0,53 0,47 1,944 0,378
ОАО “Учхоз Уралец”
GHR 50,0 34,7 15,3 0,67 0,33 37,5 47,2 15,3 0,61 0,39 5,382 0,068
CSN_AB 86,1 13,9 0,0 0,93 0,07 86,1 12,5 1,4 0,93 0,07 1,111 0,574
LEP 19,4 54,2 26,4 0,47 0,53 23,6 50,0 26,4 0,49 0,51 0,779 0,677
DGAT1 56,3 39,6 4,2 0,76 0,24 62,5 33,3 4,2 0,80 0,20 0,863 0,650
LGB 29,2 58,3 12,5 0,58 0,42 41,7 45,8 12,5 0,65 0,35 5,155 0,076

Продолжение таблицы 2

1 2 3 4 5 6 7 8 9 10 11 12 13
ООО “Агропромышленная фирма “Луч””
GHR 31,9 56,9 11,1 0,60 0,40 44,4 44,4 11,1 0,67 0,33 5,063 0,080
CSN_AB* 80,6 12,5 6,9 0,87 0,13 54,2 38,9 6,9 0,74 0,26 22,149 0,000
LEP 5,6 26,4 68,1 0,19 0,81 2,8 29,2 68,1 0,18 0,82 2,190 0,334
DGAT1 50,0 41,7 8,3 0,71 0,29 50,0 41,7 8,3 0,71 0,29 0,000 1,000
LGB 23,6 52,8 23,6 0,50 0,50 26,4 50,0 23,6 0,51 0,49 0,322 0,851

* – p уровень значимости <0.05

Гипотезу о генетических различиях по генам продуктивности между разными хозяйствами проверяли методом главных компонент (PCA-анализ). Как видно из рисунка 8 все особи формируются в большой общий кластер, без возможности выявить дифференцированные группы. Данный результат несмотря на различия долей генотипов между хозяйствами, свидетельствует об однородности и соответствует общей тенденции голштинизации чёрно-пёстрого поголовья.

word image 3 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 8 – Результат анализа методом главных компонент: А – первая и вторая главные компоненты; Б – вторая и третья.

Полученные результаты согласуются с другими отечественными исследованиями. В работе Позовниковой и др. 2017 [46] по распределению гентипов лактоглобулина наибольшая частота отмечается для гетерозигот AB – 0,601 и частоты аллелей A и B составляют 0,475 и 0,525. Генотипирование популяций голштинского скота по гену лептина, показало, что частоты аллелей A и B составили 0,57и 0,43, соответственно, при следующем распределении генотипов: AA –0,325; AB – 0,491; BB– 0,184 [47]. Подобные же распределения характерны для этого гена и у холмогорской породы [48]. Для гена каппа-казеина в поголовье голштинизированного чёрно-пёстрого скота, в зависимости от линейной принадлежности, показаны доли генотипа AA – 0,551-0,732, AB – 0,268-0,389 и BB – 0,056-0,102 [49]. А генотипирование быков-производителей голштинской и чёрно-пёстрой породы по полиморфизму гена каппа-казеина показало высокую частоту аллеля A (до 80%) по сравнению с аллелем B (до 23%) [50].

4. ВЗАИМОСВЯЗЬ ГЕНОТИПА И ФЕНОТИПА

При сопоставление фенотипических и генотипических признаков у исследуемой группы животных достоверного влияния генотипа на продуктивные характеристики не были показаны для гена бета-лактоглобулина. Ген DGAT1 значимо коррелировал (p<0,05) только с изменением двух исследуемых показателей: пожизненные содержания жира и белка. Наибольший спектр влияния удалось определить для генов CSN_AB, LEP и GHR. Доминантный аллельный вариант B каппа-казеина значимо ассоциирован с повышением выхода молока (рисунок 9).

word image 4 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 9 – Влияние гена каппа-казеина (CSN_AB) на удой. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

Гомозиготный AA и гетерозиготный варианты по лептину, сходны с влиянием гена каппа-казеина, значимо повышают удой за 305 дней первой и третьей лактации (рисунок 10). К тому же увеличивая долевые показатели жира (рисунок 11).

Изображение выглядит как текст, кроссворд Автоматически созданное описание

Рисунок 10 – Влияние гена лептина (LEP) на удой. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

Рисунок 11 – Гомозигота по аллелю A значимо коррелирует с увеличенной долей жира в молоке. word image 5 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Генотип BB рецептора гормона роста значимо увеличивает выход молока относительно вариантов с доминантным аллелем A (рисунок 12).

Изображение выглядит как текст, кроссворд Автоматически созданное описание

Рисунок 12 – Влияние гена рецептора гормона роста (GHR) на удой. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

Что касается влияния генов на живую массу то здесь удалось зафиксировать положительное влияние B аллеля каппа-казеина и A аллеля лептина (рисунок 13).

word image 6 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 13 – Показатели живой массы в зависимости от генотипа по соответствующим генам.

Показано, что LGB значимо влияет на показатели удоя, выход жира и белка [46], а наиболее предпочтительными вариантами являются AA и AB [46, 51]. Влияния на продуктивные качества этого гена нами не обнаружено.

Гены DGAT1 и GHR, по результатам анализа данных китайского поголовья голштинов, оказывали наибольшее влияния на широкий спектр продуктивных качеств, таких как удой молока, выход жира и белка, процентное содержание жира и белка [17]. В нашей работе также обнаружено широкое влияние гена рецептора гормона роста на DGAT1 значимо коррелировал (p<0,05) только с изменением двух исследуемых показателей: пожизненные содержания жира и белка.

Особи с генотипами AA и AB по гену LEP превосходят по удою, количеству молочного жира и белка рецессивных гомозигот [48], что согласуется с полученными нами результатами. Однако, в то же время есть данные, которые демонстрируют обратную тенденцию, увеличенный выход молока у особей с генотипом BB, по сравнению с доминантной гомозиготой и гетерозиготой [52].

Для гена CSN_AB описано увеличение удоя у коров с генотипом AB и BB против уменьшеного выхода молока у особей с рецессивным генотипом [53]. Такие же результаты получены и для зарубежного поголовья [54, 55].

5. СРАВНИТЕЛЬНЫЙ АНАЛИЗ ВЗАИМОСВЯЗИ ГЕНОТИПА С ФЕНОТИПОМ ПО ПРОДУКТИВНЫМ ПРИЗНАКАМ ВНУТРИ СЕЛЬСКОХОЗЯЙСТВЕННЫХ ОРГАНИЗАЦИЙ

При анализе влияния генотипов гена CSN_AB было выявлено наибольшее влияние в ООО «Новопышминское» гомозиготы ВВ по удою за 305 дней 3 лактации (+96,0 кг с гомозиготе АА и + 621,4 кг к гетерозиготе АВ); массовой доли жара в 3 лактацию (+0,11% к АА и +0,19% к АВ); массовой доли белка по 3 лактации (+0,12% к АА и +0,15% к АВ); жир по 3 лактации (+16,3 кг к АА и +36,3 кг к АВ); белок по 3 лактации (+17,6 кг к АА и +36,3 кг к АВ); пожизненный удой (+5951,0 кг к АА и 4248,7 кг к АВ); пожизненный жир (+192,8 кг к АА и 220,7 кг к АВ). Генотип АВ проявился в увеличении возраста, измеряемое лактациями (+0,3 к гомозиготам); удои за 305 дней 1 лактации (+269,7 кг к АА и +199,0 кг к ВВ); массовой доли жира по 1 лактации (+0,11% к АА и +0,12% к ВВ). В ООО «Бородулинское» генотип АА показал максимальный эффект в получении пожизненной продуктивности:пожизненный удой (+3168,8 кг к АВ и 5008,0 кг к ВВ); пожизненный жир (+94,1 кг к АВ и +112,8 кг к ВВ); пожизненный белок (+63,7 кг к АВ и +68,6 кг к ВВ). Влияние гетерозиготы проявилось в удоях за 305 дней 1 и3 лактации (+655,1 кг и +343,5 кг к АА и +650,5 кг и +1056,0 к ВВ соответственно по лактациям), выход молочного жира за 305 дней 1 и 3 лактации (+31,8 кг и +6,2 кг к АА и +23,6 кг и +29,1 к ВВ соответственно по лактациям), выход молочного белка за 305 дней 1 и 3 лактации (+22,4 кг и +6,9 кг к АА и +19,6 кг и +22,6 к ВВ соответственно по лактациям). Генотип ВВ проявился в увеличении возраста, измеряемое лактациями (+0,1 к АА и +0,8 к АВ), массовой доли жира по 1 и 3 лактациям (+0,11% и +0,08% к АА, +0,06% и +0,17% к АВ соответственно по лактациям), массовой доли белка по 1 и 3 лактациям (+0,04% и +0,08% к АА и +0,06 и +0,17% к АВ соответственно), показателе живой массы в 1 и 3 лактацию (+63,5 кг и +34,5 кг к АА и +44,6 кг и +27,1 кг к АВ соответственно). В ОАО «Учхоз «Уралец» выявлены только два генотипа – АА и АВ. Возраст, измеряемый в лактациях, был выше в гетерозиготной группе на одну лактацию. В этой же группе на 0,01% была выше массовая доля жира в 1 и 3 лактации, больше на 8209,0 кг – пожизненный удой, 320,5 кг – пожизненный выход молочного жира и 239,1 кг – пожизненный выход белка. В гомозиготной группе значительная разница была в удое по 3 лактации (+791,6 кг), выход молочного жира и выход молочного белка по 3 лактации (+31,4 кг и +28,7 кг соответственно показателям), массовой доле белка по 3 лактации (+0,05%). В ООО Агропромышленная фирма «Луч» наибольшее количество показателей с наивысшим значением приходится на гомозиготный генотип ВВ – удой ща 305 дней 1 и 3 лактаций (+638,2 кг и 191,8 кг к гомозиготе АА; + 1295,3 кг и +388,9 кг к гетерозиготе АВ соответственно по лактациям), массовая доля жира за 3 лактацию (+0,32% к АА и +0,33% к АВ), выход молочного жира по 1 и 3 лактациям (+20,1 кг и 29,8 кг к АА; +24,8 кг и 40,6 кг к АВ соответственно по лактациям); выход молочного белка за 1 и 3 лактации (+11,0 кг и +17,6 кг к АА; +36,7 кг и +7,1 кг к АВ соответственно по лактациям); пожизненная продуктивность: по удою (+5939,2 кг к АА и 9568,6 кг к АВ), выходу молочного жира (+42,9 кг к АА и 197,6 кг к АВ), выходу молочного белка (+6,7 кг к АА и +139,8 кг к АВ). Проявление генотипа АВ наблюдается в таких показателях, как возраст в лактациях (+0,6 к АА и +0,3 к ВВ), массовой доле жира за 1 лактацию (+0,37% к АА и +0,52% к ВВ), массовой доли белка по 3 лактации (+0,2% к АА и +0,05% к ВВ). Значимая разница в показателе массовой доли белка по 1 лактации была у генотипа АА (+0,11% к АВ и +0,15% к ВВ) (рисунок 14-19, таблица 3).

word image 7 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 14– Разница в показателе удоя в группах животных с разными генотипами гена CSN_AB

word image 8 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 15– Разница в показателе МД жиро- и белковомолочности в группах животных с разными генотипами гена CSN_AB

word image 9 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 16– Разница в показателе абсолютной жиро- и белковомолочности в группах животных с разными генотипами гена CSN_AB

word image 10 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 17– Разница в показателе пожизненной продуктивности в группах животных с разными генотипами гена CSN_AB

word image 11 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 18– Разница в показателе пожизненной продуктивности по жиру и белку в группах животных с разными генотипами гена CSN_AB

word image 12 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 19– Разница в показателе живой массы в группах животных с разными генотипами гена CSN_AB

Таблица 3 – Взаимосвязь генотипов гена CSN_AB с продуктивностью коров в разрезе сельскохозяйственных организаций

Показатель AA AB BB p-значение
Mean ± se sd Mean ± se sd Mean ± se sd
1 2 3 4 5 6 7 8
ООО «Новопышминское»
Возраст в лактациях 5,3±0,14 0,66 5,6±0,15 0,67 5,3±0,42 1,03 0,58
Удой за 305 дней 1 лактации, кг 8458,6±304,27 1394,32 8728,3±296,85 1360,34 8529,33±490,573 1201,65 0,72
Удой за 305 дней 3 лактации, кг 10749,7±320,00 1466,44 10224,2±293,90 1346,83 10845,7±866,47 2122,42 0,71
Жир за 305 дней 1 лактации, % 3,88±0,070 0,32 3,98±0,060 0,28 3,86±0,119 0,29 0,69
Жир за 305 дней 3 лактации, % 3,83±0,049 0,22 3,75±0,047 0,21 3,95±0,083 0,20 0,72
Жир за 305 дней 1 лактации, кг 329,5±15,01 68,82 347,4±12,88 59,04 330,5±24,44 59,86 0,68
Жир за 305 дней 3 лактации, кг 411,7±12,87 58,99 382,7±10,06 46,12 428,0±35,33 86,54 0,83
Белок за 305 дней 1 лактации, % 3,21±0,029 0,13 3,21±0,034 0,16 3,20±0,057 0,14 0,96
Белок за 305 дней 3 лактации, % 3,14±0,023 0,11 3,11±0,029 0,13 3,26±0,071 0,17 0,23
Белок за 305 дней 1 лактации,кг 271,5±10,22 46,82 280,68±10,477 48,01 273,8±18,27 44,75 0,72
Белок за 305 дней 3 лактации,кг 336,3±9,12 41,78 317,7±9,69 44,43 353,9±31,19 76,41 0,94
Удой пожизненный, кг 54509,3±1536,96 7043,22 56211,6±1429,17 6549,30 60460,3±4741,47 11614,19 0,11
Жир пожизненный, кг 2253,9±67,94 311,33 2242,3±58,61 268,61 2446,8±138,87 340,18 0,31
Белок пожизненный, кг 1834,2±50,26 230,34 1821,8±50,90 233,25 2042,5±127,32 311,88 0,19
ООО «Бородулинское»
Возраст в лактациях 5,9±0,26 1,49 5,2±0,14 0,56 6,0±0,00 0,00 0,23
Удой за 305 дней 1 лактации, кг 6737,3±154,68 861,25 7392,4±246,88 956,17 6742,0±945,00 1336,43 0,11
Удой за 305 дней 3 лактации, кг 8601,1±252,53 1406,07 8944,5±261,61 1013,24 7888,5±629,50 890,25 0,87
Жир за 305 дней 1 лактации, % 4,18±0,026 0,15 4,23±0,022 0,09 4,29±0,010 0,01 0,11

Продолжение таблицы 3

1 2 3 4 5 6 7 8
Жир за 305 дней 3 лактации, % 4,14±0,029 0,16 4,04±0,036 0,14 4,22±0,015 0,02 0,36
Жир за 305 дней 1 лактации, кг 281,2±6,31 35,19 313,0±11,35 43,97 289,4±41,10 58,12 0,05
Жир за 305 дней 3 лактации, кг 355,4±10,39 57,86 361,7±10,81 41,87 332,55±27,550 38,96 0,94
Белок за 305 дней 1 лактации, % 3,16±0,015 0,08 3,18±0,006 0,02 3,20±0,005 0,01 0,26
Белок за 305 дней 3 лактации, % 3,16±0,015 0,08 3,11±0,024 0,09 3,24±0,105 0,15 0,64
Белок за 305 дней 1 лактации,кг 212,7±4,93 27,49 235,2±8,14 31,56 215,6±30,40 42,99 0,08
Белок за 305 дней 3 лактации,кг 271,4±7,84 43,69 278,4±8,24 31,92 255,8±28,80 40,73 0,93
Удой пожизненный, кг 43309,4±2071,44 11533,30 40140,7±1407,74 5452,18 38301,5±1273,50 1801,00 0,25
Жир пожизненный, кг 1948,1±95,07 529,35 1854,1±76,86 297,70 1835,3±172,00 243,24 0,51
Белок пожизненный, кг 1497,6±72,66 404,56 1433,7±59,96 232,21 1429,0±154,90 219,06 0,57
Живая масса при 1 лактации, кг 596,5±8,54 47,55 615,3±11,15 43,20 660,0±20,00 28,28 0,04
Живая масса при 3 лактации, кг 641,4±6,87 38,28 648,9±11,34 43,91 676,0±17,00 24,04 0,26
ОАО «Учхоз «Уралец»
Возраст в лактациях 5,3±0,23 1,49 6,3±0,33 0,82 0,11
Удой за 305 дней 1 лактации, кг 5807,1±101,34 656,80 5796,8±296,11 725,33 0,97
Удой за 305 дней 3 лактации, кг 7405,1±149,43 968,46 6613,5±400,60 981,29 0,07
Жир за 305 дней 1 лактации, % 4,00±0,018 0,12 4,01±0,055 0,14 0,96
Жир за 305 дней 3 лактации, % 3,99±0,022 0,14 4,00±0,045 0,11 0,88
Жир за 305 дней 1 лактации, кг 232,2±3,88 25,18 232,3±12,48 30,58 0,99
Жир за 305 дней 3 лактации, кг 295,6±6,58 42,68 264,18±15,646 38,32 0,09
Белок за 305 дней 1 лактации, % 3,10±0,015 0,10 3,09±0,059 0,15 0,82
Белок за 305 дней 3 лактации, % 3,13±0,015 0,10 3,08±0,050 0,12 0,25
Белок за 305 дней 1 лактации,кг 179,8±3,05 19,81 179,0±9,58 23,47 0,93

Продолжение таблицы 3

1 2 3 4 5 6 7 8
Белок за 305 дней 3 лактации,кг 231,7±5,10 33,07 203,0±10,81 26,48 0,05
Удой пожизненный, кг 37982,0±1501,16 9728,66 46191,0±5049,47 12368,63 0,07
Жир пожизненный, кг 1724,5±57,06 369,83 2045,0±167,66 410,70 0,06
Белок пожизненный, кг 1340,7±44,92 291,13 1579,8±127,55 312,44 0,07
Живая масса при 1 лактации, кг 528,8±7,27 47,14 526,7±8,03 19,66 0,91
Живая масса при 3 лактации, кг 578,9±5,61 36,42 552,5±12,65 31,00 0,10
ООО Агропромышленная фирма «Луч»
Возраст в лактациях 6,0±0,20 1,28 6,6±0,68 1,52 6,3±0,88 1,53 0,42
Удой за 305 дней 1 лактации, кг 5132,4±249,67 1559,19 4475,4±481,56 1076,81 5770,7±978,64 1695,07 0,88
Удой за 305 дней 3 лактации, кг 7391,5±223,12 1411,11 7194,4±566,26 1266,20 7583,3±190,39 329,77 0,96
Жир за 305 дней 1 лактации, % 3,74±0,062 0,39 4,10±0,165 0,37 3,60±0,210 0,36 0,66
Жир за 305 дней 3 лактации, % 3,74±0,051 0,32 3,73±0,144 0,32 4,06±0,643 1,11 0,27
Жир за 305 дней 1 лактации, кг 190,5±9,28 57,98 185,7±26,50 59,26 210,6±42,83 74,20 0,69
Жир за 305 дней 3 лактации, кг 276,1±9,14 57,82 265,4±14,18 31,71 306,0±42,31 73,29 0,59
Белок за 305 дней 1 лактации, % 3,12±0,035 0,22 3,01±0,082 0,18 2,97±0,225 0,39 0,17
Белок за 305 дней 3 лактации, % 3,10±0,041 0,26 3,30±0,171 0,38 3,25±0,127 0,22 0,13
Белок за 305 дней 1 лактации,кг 161,8±8,97 56,06 136,1±18,80 42,04 172,9±33,85 58,63 0,85
Белок за 305 дней 3 лактации,кг 229,0±7,27 46,01 239,5±26,24 58,68 246,6±10,44 18,09 0,45
Удой пожизненный, кг 41676,8±1279,49 8092,22 38047,4±4757,46 10638,02 47616,0±1988,11 3443,51 0,58
Жир пожизненный, кг 1941,6±48,80 308,68 1787,0±218,98 489,67 1984,7±257,43 445,89 0,77
Белок пожизненный, кг 1548,3±37,38 236,41 1415,3±182,04 407,07 1555,1±173,87 301,15 0,63
Живая масса при 1 лактации, кг 501,5±6,7 42,98 504,4±15,27 34,15 503,7±18,80 32,56 0,89
Живая масса при 3 лактации, кг 566,8±7,61 48,10 554,8±25,41 56,82 533,7±20,58 35,64 0,23

Взаимосвязь генотипов гена DGAT1 с продуктивными признаками так же проявилась по-разному в сельскохозяйственных организациях (рисунки 20 – 25, таблица 4). В ООО «Новопышминское» максимальные значения по генотипу АА получены массовой доле жира за 1 лактацию (+0,12% к АВ и +0,20% к ВВ), массовой доле белка за 1 лактацию (+0,03% к АВ и 0,10% к ВВ), выход молочного жира за 1 лактацию (+8,9 кг к АВ и +2,12 кг к ВВ), выход молочного белка за 1 лактацию (+6,7 кг к АА и +139,8 кг к АВ). Разница в показатели удоя за 305 дней 1 лактации между генотипом ВВ и генотипами АА и АВ была +252,9 кг и +210,7 кг соответственно; по массовой доле жира за 3 лактацию эта разница составила 0,11% и 0,23% соответственно по генотипам; выход молочного жира за 3 лактацию (+16,0 кг к АА и 3,9 кг к АВ); пожизненная продуктивность: по удою (+3583,8 кг к АА и +522,1 кг к АВ), по жиру (+174,3 кг к АА и +9,41 кг к АВ), по белку (+177,3 кг к АА и +31,6 кг к АВ). Удой за 305 дней 3 лактации был наиболее высоким в группе с генотипом АВ и превышал показатели групп с генотипом АА на 580,3 кг и генотипом ВВ на 494,1 кг. В ООО «Бородулинское» в группе с генотипом АА по удою за 3 лактацию выше на 622,4 кг по сравнению с АВ и на 1524,3 кг с генотипом ВВ; выход молочного жира за 3 лактацию – с АВ +15,9 кг и с ВВ + 49,0 кг; выход молочного белка за 3 лактацию больше на 6,5 кг и 10,9 кг соответственно по генотипам, пожизненная продуктивность по удою превысила на 1666,0 кг генотип АВ и на 551,7 генотип ВВ. Генотип АВ проявился в показателе массовой доли белка за 3 лактацию (+0,07% к генотипу АА); пожизненное получение жира (+49,7 кг к генотипу АА и +27,4 кг к генотипу ВВ); пожизненное получение белка (+30,4 кг к генотипу АА и +23,0 кг к генотипу ВВ). Возраст, исчисляемый в лактациях в группе с генотипом ВВ превысил на 0,7 показатель второй гомозиготы и гетерозиготы; удой за 305 дней 1 лактации выше на 614,5 кг по сравнению с АА и на 459,3 кг с генотипом АВ; массовая доля жира по 3 лактации +0,15% и +0,04% соответственно по генотипам; выход молочного жира за 1 лактацию +18,5 кг к гентипу АА и + 12,3 кг к генотипу АВ; выход молочного белка за 1 лактацию +18,4 кг к генотипу АА и +13,7 кг к генотипу АВ. В ООО «Учхоз «Уралец» по генотипу АА – удой за 305 дней 3 лактации (+460,9 кг к генотипу ВВ); массовая доля жира по 1 лактации (+0,11% к генотипу ВВ); выход молочного белка за 3 лактацию (+13,9 кг к генотипу АВ и +42,5 кг к генотипу ВВ); пожизненный удой (+1666,1 кг к генотипу АВ и +551,7 кг к генотипу ВВ). По генотипу АВ – удой за 305 дней 3 лактации (+460,9 кг к генотипу ВВ); массовая доля жира по 1 лактации (+0,11% к генотипу ВВ); выход молочного белка за 3 лактацию (+13,9 кг к генотипу АВ и +42,5 кг к генотипу ВВ); пожизненный удой (+1666,1 кг к генотипу АВ и +551,7 кг к генотипу ВВ). В ООО Агропромышленная фирма «Луч» по генотипу АА – удой за 305 дней 1 лактации (+1170,2 кг к генотипу ВВ), выход молочного жира по 1 лактации (+7,8 кг к генотипу АВ и +36,3 кг к генотипу ВВ), массовая доля белка по 3 лактации (+0,03% к АВ и ВВ), выход белка по 1 лактации (+38,3 кг к генотипу ВВ), пожизненная продуктивность: удой (+3699,8 кг к генотипу АВ и +3727,1 кг к генотипу ВВ), жир (+44,6 кг к генотипу АВ), белок (+23,6 кг к генотипу АВ). По генотипу АВ – массовая доля жира по 3 лактации (+0,08 % к генотипу АА и +0,17% к генотипу ВВ). По генотипу ВВ – удой за 305 дней 3 лактации (+200,4 кг к генотипу АВ), массовая доля белка 1 лактации (+0,07 % к генотипу АВ).

word image 13 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 20– Разница в показателе удоя в группах животных с разными генотипами гена DGAT1

word image 14 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 21– Разница в показателе МД жиро- и белковомолочности в группах животных с разными генотипами гена DGAT1

 

word image 15 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 22– Разница в показателе абсолютной жиро- и белковомолочности в группах животных с разными генотипами гена DGAT1

word image 16 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 23– Разница в показателе пожизненной продуктивности в группах животных с разными генотипами гена DGAT1

word image 17 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 24– Разница в показателе пожизненной продуктивности по жиру и белку в группах животных с разными генотипами гена DGAT1

word image 18 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 25– Разница в показателе живой массы в группах животных с разными генотипами гена DGAT1

Таблица 4 – Взаимосвязь генотипов гена DGAT1 на продуктивность коров в разрезе сельскохозяйственных организаций

Показатель AA AB BB p-значение
Mean ± se sd Mean ± se sd Mean ± se sd
1 2 3 4 5 6 7 8
ООО «Новопышминское»
Возраст в лактациях 5,5±0,17 0,76 5,47±0,177 0,77 5,3±0,17 0,50 0,60
Удой за 305 дней 1 лактации, кг 8521,3±362,41 1620,73 8563,53±261,446 1139,62 8774,2±376,39 1129,17 0,67
Удой за 305 дней 3 лактации, кг 10285,9±361,43 1616,37 10866,26±341,599 1489,00 10372,1±412,87 1238,62 0,66
Жир за 305 дней 1 лактации, % 4,01±0,071 0,32 3,89±0,065 0,28 3,81±0,084 0,25 0,07
Жир за 305 дней 3 лактации, % 3,84±0,050 0,22 3,72±0,042 0,18 3,95±0,08 0,23 0,51
Жир за 305 дней 1 лактации, кг 342,5±16,75 74,92 333,62±12,866 56,08 334,4±17,44 52,33 0,70
Жир за 305 дней 3 лактации, кг 393,2±12,52 56,02 405,3715,143 66,01 409,3±17,94 53,85 0,45
Белок за 305 дней 1 лактации, % 3,24±0,024 0,11 3,21±0,035 0,15 3,14±0,057 0,17 0,07
Белок за 305 дней 3 лактации, % 3,15±0,024 0,11 3,08±0,027 0,12 3,24±0,053 0,16 0,28
Белок за 305 дней 1 лактации, кг 276,7±12,38 55,39 274,99±9,391 40,93 275,4±13,11 39,33 0,93
Белок за 305 дней 3 лактации, кг 323,3±11,21 50,17 335,35±12,398 54,04 335,3±11,17 33,53 0,47
Удой пожизненный, кг 54114,1±1641,69 7341,88 57175,8±1978,55 8624,32 57697,9±1687,75 5063,27 0,18
Жир пожизненный, кг 2175,1±73,23 327,53 2339,9±59,57 259,70 2349,3±90,29 270,89 0,08
Белок пожизненный, кг 1763,9±57,73 258,18 1909,6±55,37 241,35 1941,2±61,74 185,24 0,04
ООО «Бородулинское»
Возраст в лактациях 5,6±0,32 1,24 5,6±0,19 1,01 6,3±0,919 2,25 0,36
Удой за 305 дней 1 лактации, кг 6778,1±242,71 940,00 6933,4±186,52 969,18 7392,7±307,88 754,17 0,21
Удой за 305 дней 3 лактации, кг 9219,3±357,04 1382,84 8596,9±225,31 1170,76 7695,0±373,82 915,69 0,01
Жир за 305 дней 1 лактации, % 4,22±0,034 0,13 4,21±0,023 0,12 4,11±0,062 0,15 0,16

Продолжение таблицы 4

1 2 3 4 5 6 7 8
Жир за 305 дней 3 лактации, % 4,03±0,042 0,16 4,14±0,022 0,12 4,18±0,095 0,23 0,02
Жир за 305 дней 1 лактации, кг 285,7±10,45 40,50 291,9±8,17 42,50 304,2±14,62 35,82 0,37
Жир за 305 дней 3 лактации, кг 371,5±15,21 58,91 355,6±8,99 46,76 322,5±20,20 49,48 0,06
Белок за 305 дней 1 лактации, % 3,17±0,020 0,08 3,17±0,013 0,07 3,16±0,030 0,07 0,62
Белок за 305 дней 3 лактации, % 3,10±0,024 0,09 3,17±0,016 0,08 3,16±0,041 0,10 0,06
Белок за 305 дней 1 лактации, кг 214,9±7,74 30,01 219,6±6,14 31,93 233,3±10,04 24,61 0,25
Белок за 305 дней 3 лактации, кг 286,1±11,41 44,18 272,1±6,93 36,06 243,6±13,38 32,77 0,03
Удой пожизненный, кг 43116,7±2738,94 10607,88 41450,6±1747,60 9080,82 42565,0±5145,08 12602,82 0,78
Жир пожизненный, кг 1883,3±114,25 442,49 1933,0±90,21 468,79 1905,5±210,51 515,63 0,84
Белок пожизненный, кг 1456,8±88,05 341,05 1487,1±68,05 353,60 1464,1±170,27 417,09 0,90
Живая масса при 1 лактации, кг 608,0±12,51 48,48 606,1±8,260 42,92 592,7±27,53 67,45 0,57
Живая масса при 3 лактации, кг 656,3±10,39 40,25 643,1±6,72 34,95 627,3±22,89 56,08 0,12
ОАО «Учхоз «Уралец»
Возраст в лактациях 5,6±0,32 1,24 5,6±0,19 1,01 6,3±0,91 2,25 0,36
Удой за 305 дней 1 лактации, кг 6778,1±242,70 940,00 6933,4±186,52 969,18 7392,7±307,88 754,17 0,21
Удой за 305 дней 3 лактации, кг 9219,3±357,04 1382,84 8596,9±225,31 1170,76 7695,0±373,82 915,69 0,01
Жир за 305 дней 1 лактации, % 4,22±0,034 0,13 4,21±0,023 0,12 4,11±0,062 0,15 0,16
Жир за 305 дней 3 лактации, % 4,03±0,042 0,16 4,14±0,022 0,12 4,18±0,095 0,23 0,02
Жир за 305 дней 1 лактации, кг 285,7±10,45 40,50 291,9±8,17 42,50 304,2±14,62 35,82 0,37
Жир за 305 дней 3 лактации, кг 371,5±15,21 58,91 355,6±8,99 46,76 322,4±20,20 49,48 0,06
Белок за 305 дней 1 лактации, % 3,17±0,020 0,08 3,17±0,013 0,07 3,16±0,030 0,07 0,62
Белок за 305 дней 3 лактации, % 3,10±0,024 0,09 3,17±0,016 0,08 3,16±0,041 0,10 0,06
Белок за 305 дней 1 лактации, кг 214,9±7,74 30,01 219,6±6,14 31,93 233,3±10,05 24,61 0,25
Белок за 305 дней 3 лактации, кг 286,1±11,41 44,18 272,2±6,93 36,06 243,6±13,38 32,77 0,03

Продолжение таблицы 4

1 2 3 4 5 6 7 8
Удой пожизненный, кг 43116,7±2738,94 10607,88 41450,6±1747,61 9080,82 42565,0±5145,08 12602,82 0,78
Жир пожизненный, кг 1883,3±114,25 442,49 1933,0±90,21 468,79 1905,5±210,51 515,63 0,84
Белок пожизненный, кг 1456,8±88,05 341,05 1487,1±68,05 353,60 1464,1±170,27 417,09 0,90
Живая масса при 1 лактации, кг 608,0±12,51 48,48 606,1±8,26 42,92 592,7±27,53 67,45 0,57
Живая масса при 3 лактации, кг 656,3±10,39 40,25 643,1±6,72 34,95 627,3±22,89 56,08 0,12
ООО Агропромышленная фирма «Луч»
Возраст в лактациях 6,1±0,23 1,15 6,0±0,355 1,59 6,2±0,25 0,50 0,95
Удой за 305 дней 1 лактации, кг 5212,7±321,15 1573,28 5188,3±357,19 1556,96 4042,5±226,49 452,99 0,31
Удой за 305 дней 3 лактации, кг 7440,2±259,84 1272,99 7292,3±329,15 1472,02 7492,7±698,63 1397,26 0,88
Жир за 305 дней 1 лактации, % 3,79±0,084 0,41 3,70±0,093 0,41 3,98±0,095 0,19 0,82
Жир за 305 дней 3 лактации, % 3,73±0,068 0,33 3,81±0,108 0,49 3,64±0,057 0,11 0,91
Жир за 305 дней 1 лактации, кг 197,5±13,28 65,05 189,7±12,13 52,86 161,3±12,43 24,88 0,29
Жир за 305 дней 3 лактации, кг 277,1±10,59 51,92 277,4±14,29 63,93 273,3±26,87 53,75 0,94
Белок за 305 дней 1 лактации, % 3,12±0,041 0,20 3,06±0,061 0,27 3,13±0,102 0,20 0,70
Белок за 305 дней 3 лактации, % 3,15±0,054 0,26 3,12±0,065 0,29 3,12±0,184 0,37 0,72
Белок за 305 дней 1 лактации, кг 164,6±11,77 57,68 160,8±12,64 55,13 126,3±6,94 13,88 0,31
Белок за 305 дней 3 лактации, кг 234,8±9,69 47,52 226,1±9,69 43,35 234,9±28,43 56,85 0,72
Удой пожизненный, кг 43522,1±1792,67 8782,29 39822,3±1790,10 8005,61 39795,0±1949,49 3898,99 0,16
Жир пожизненный, кг 1947,7±68,29 334,58 1903,1±74,89 334,94 1937,3±195,99 391,98 0,77
Белок пожизненный, кг 1545,3±51,80 253,77 1521,7±59,52 266,16 1538,4±150,17 300,34 0,84
Живая масса при 1 лактации, кг 510,2±10,15 49,74 491,3±6,62 29,61 505,2±10,61 21,22 0,31
Живая масса при 3 лактации, кг 563,7±9,45 46,30 559,2±12,01 53,71 584,0±15,86 31,74 0,72

Влияние генотипов гена GHR. ООО «Новопышминское» (рисунки 26 – 31, таблица 5). Генотип АА – массовая доля белка по 3 лактации (+0,05% к ВВ). По генотипу АВ – массовая доля жира по 3 лактации (+0,04 % к генотипу АА и +0,08% к генотипу ВВ), массовая доля белка 3 лактации (+0,05 % к генотипу ВВ).

По генотипу ВВ – удой за 305 дней 1 лактации (+496,0 кг к генотипу АА и +519,0 к генотипу АВ), удой за 305 дней 3 лактации (+565,9 кг к генотипу АА и +583,5 кг к генотипу АВ), выход молочного жира по 1 лактации (+14,1 кг к генотипу АА и +24,3 кг к генотипу АВ), выход молочного жира по 3 лактации (+16,3 кг к генотипу АА и +14,1 кг к генотипу АВ), выход белка по 1 лактации (+14,8 кг к генотипу АА и +17,1 кг к генотипу АВ), выход белка по 3 лактации (+11,3 по генотипу АА и +13,5 кг к генотипу ВВ), пожизненная продуктивность: удой (+3410,8 кг к генотипу АА и +1303,4 кг к генотипу АВ), жир (+105,6 кг к генотипу АА и +92,2 кг к генотипу АВ), белок (+86,5 кг к генотипу АА и +23,6 кг к генотипу АВ). ООО «Бородулинское». Генотип АА – массовая доля белка по 1 лактации (+0,03% к генотипу АВ и +0,02% к генотипу ВВ), по 3 лактации (+0,02% и +0,04% соответственно к генотипам). Генотип АВ – удой за 305 дней 3 лактации (+199,2 кг к генотипу АА и +689,8 кг к генотипу ВВ); выходу белка за 3 лактацию (+5,9 кг к АА и +23,9 кг к ВВ); пожизненные показатели: удой (+651,3 кг к АА и +9289,4 к ВВ), жир (+128,4 кг к АА и +450,8 кг к ВВ), белок (+102,6 кг к АА и +351, 5 кг к ВВ). Генотип ВВ – удой за 305 дней 1 лактации + 160,1 кг к АВ. ОАО «Учхоз «Уралец». Генотип АВ – удой за 305 дней 1 лактации (+118,3 кг к АА и +83,1 кг к ВВ); массовая доля жира за 3 лактацию (+0,9% к АА и 0,11% к ВВ); пожизненные показатели: удой (+1896,6 кг к АА и +2155,5 кг к ВВ), жир (+20,1 кг к АА и + 57,2 кг к ВВ), белок (+34,6 кг к ВВ). Генотип ВВ – удой за 305 дней 3 лактации (+214,0 кг к АА и +450,4 кг ВВ); массовая доля жира по 1 лактации (+0,06% по АА и +0,07% к АВ). ООО Агропромышленная фирма «Луч». Генотип АА – удой за 305 дней 1 лактации (+504,7 кг к АВ и +885,6 кг к генотипу ВВ); массовая доля белка 1 лактации (+0,13% к АВ и +0,05% к ВВ); выход молочного жира за 1 лактацию (+8,5 кг к АВ и +33,9 кг к ВВ); выход молочного белка за 1 лактацию (+23,1 кг к АВ и +31,0 кг к ВВ). Генотип АВ – массовая доля жира 1 лактации (+0,22% к АА и 0,22% к ВВ); массовая доля жира 3 лактации (+0,17% к АА и +0,18% к ВВ); массовая доля белка 3 лактации (+0,04% к АА и +0,15% к ВВ); пожизненный удой (+6305,2 кг к АА и +492,4 кг ВВ). Генотип ВВ – удой за 305 дней 3 лактации (+515,1 кг к АА и +412,5 кг к АВ); выход молочного жира за 3 лактацию (+14,6 кг к АА); пожизненный выход молочного жира (+239,8 кг к АА); пожизненный выход молочного белка (+174,7 кг к АА).

word image 19 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 26– Разница в показателе удоя в группах животных с разными генотипами гена GHR

word image 20 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 27– Разница в показателе МД жиро- и белковомолочности в группах животных с разными генотипами гена GHR

word image 21 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 28– Разница в показателе абсолютной жиро- и белковомолочности в группах животных с разными генотипами гена GHR

word image 22 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 29– Разница в показателе пожизненной продуктивности в группах животных с разными генотипами гена GHR

word image 23 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 30– Разница в показателе пожизненной продуктивности по жиру и белку в группах животных с разными генотипами гена GHR

word image 24 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 31– Разница в показателе живой массы в группах животных с разными генотипами гена GHR

Таблица 5 – Взаимосвязь генотипов гена GHR на продуктивность коров в разрезе сельскохозяйственных организаций

Показатель AA AB BB p-значение
Mean ± se sd Mean ± se sd Mean ± se sd
1 2 3 4 5 6 7 8
ООО «Новопышминское»
Возраст в лактациях 5,5±0,21 0,83 5,4±0,18 0,66 5,4±0,15 0,69 0,95
Удой за 305 дней 1 лактации, кг 8385,0±366,20 1418,29 8362,0±334,31 1205,37 8881,0±304,79 1363,09 0,26
Удой за 305 дней 3 лактации, кг 10300,7±481,85 1866,20 10283,2±253,09 912,53 10866,7±335,56 1500,67 0,25
Жир за 305 дней 1 лактации, % 3,99±0,092 0,35 3,86±0,081 0,29 3,91±0,057 0,26 0,49
Жир за 305 дней 3 лактации, % 3,82±0,036 0,14 3,86±0,065 0,23 3,78±0,059 0,27 0,55
Жир за 305 дней 1 лактации, кг 334,3±16,01 62,03 324,2±17,06 61,50 348,5±14,68 65,66 0,48
Жир за 305 дней 3 лактации, кг 393,7±19,01 73,64 395,9±10,21 36,81 409,9±13,42 60,04 0,41
Белок за 305 дней 1 лактации, % 3,22±0,029 0,11 3,20±0,041 0,15 3,21±0,036 0,16 0,77
Белок за 305 дней 3 лактации, % 3,16±0,032 0,13 3,16±0,044 0,16 3,11±0,027 0,12 0,18
Белок за 305 дней 1 лактации, кг 270,2±12,07 46,74 267,9±11,82 42,63 285,1±10,94 48,93 0,33
Белок за 305 дней 3 лактации, кг 326,2±15,97 61,87 324,0±8,06 29,06 337,6±10,94 48,95 0,48
Удой пожизненный, кг 54006,1±2041,81 7907,92 56113,5±1708,06 6158,52 57416,8±1821,54 8146,21 0,19
Жир пожизненный, кг 2225,3±77,11 298,64 2238,8±71,14 256,51 2330,9±72,80 325,58 0,29
Белок пожизненный, кг 1814,6±61,05 236,47 1830,1±62,89 226,78 1901,1±60,78 271,82 0,30
ООО «Бородулинское»
Возраст в лактациях 5,7±0,27 1,36 5,8±0,27 1,21 4,8±0,37 0,84 0,32
Удой за 305 дней 1 лактации, кг 6942,1±171,34 839,38 6909,1±257,15 1120,89 7069,2±341,91 764,55 0,88

Продолжение таблицы 5

1 2 3 4 5 6 7 8
Удой за 305 дней 3 лактации, кг 8650,9±262,84 1287,68 8850,1±295,18 1286,67 8160,4±596,48 1333,78 0,75
Жир за 305 дней 1 лактации, % 4,20±0,024 0,12 4,20±0,036 0,16 4,20±0,039 0,09 0,96
Жир за 305 дней 3 лактации, % 4,12±0,027 0,13 4,09±0,037 0,16 4,14±0,115 0,26 0,97
Жир за 305 дней 1 лактации, кг 291,4±7,08 34,67 290,2±11,46 49,95 297,1±15,89 35,55 0,87
Жир за 305 дней 3 лактации, кг 355,9±10,37 50,83 361,9±12,54 54,69 338,0±25,02 55,96 0,74
Белок за 305 дней 1 лактации, % 3,18±0,011 0,05 3,15±0,021 0,09 3,16±0,019 0,04 0,24
Белок за 305 дней 3 лактации, % 3,16±0,016 0,08 3,14±0,023 0,10 3,12±0,048 0,11 0,34
Белок за 305 дней 1 лактации,кг 220,8±5,41 26,49 217,9±8,52 37,16 223,1±11,08 24,77 0,97
Белок за 305 дней 3 лактации,кг 272,9±7,94 38,90 278,1±9,52 41,53 253,6±17,41 38,93 0,61
Удой пожизненный, кг 42752,5±1759,20 8618,30 43403,8±2633,72 11480,14 34114,4±2233,06 4993,29 0,23
Жир пожизненный, кг 1896,8±74,98 367,33 2025,1±123,45 538,13 1574,3±183,58 410,50 0,55
Белок пожизненный, кг 1460,1±58,10 284,66 1562,7±93,27 406,56 1211,2±144,94 324,11 0,56
Живая масса при 1 лактации, кг 602,9±11,51 56,41 603,2±9,14 39,86 622,0±7,84 17,54 0,54
Живая масса при 3 лактации, кг 650,7±9,84 48,22 639,6±6,96 30,36 640,0±11,23 25,13 0,39
ОАО «Учхоз «Уралец»
Возраст в лактациях 5,4±0,23 1,13 5,4±0,43 1,81 5,6±0,65 1,72 0,74
Удой за 305 дней 1 лактации, кг 5758,7±132,14 647,40 5877,1±176,74 728,75 5794,0±220,42 583,18 0,75
Удой за 305 дней 3 лактации, кг 7358,7±166,87 817,54 7122,2±282,86 1166,27 7572,7±444,15 1175,12 0,90
Жир за 305 дней 1 лактации, % 4,00±0,018 0,09 3,99±0,034 0,14 4,06±0,060 0,16 0,37
Жир за 305 дней 3 лактации, % 3,96±0,028 0,14 4,05±0,032 0,13 3,94±0,046 0,12 0,64
Жир за 305 дней 1 лактации, кг 230,1±5,41 26,49 234,0±6,26 25,80 234,9±9,35 24,73 0,60
Жир за 305 дней 3 лактации, кг 291,4±7,15 35,07 288,9±12,19 50,26 299,1±20,70 54,78 0,80
Белок за 305 дней 1 лактации, % 3,11±0,018 0,09 3,09±0,030 0,12 3,08±0,039 0,10 0,48
Белок за 305 дней 3 лактации, % 3,11±0,020 0,10 3,13±0,028 0,12 3,14±0,023 0,06 0,41

Продолжение таблицы 5

1 2 3 4 5 6 7 8
Белок за 305 дней 1 лактации,кг 178,9±4,16 20,39 181,2±5,11 21,07 178,5±7,11 18,80 0,93
Белок за 305 дней 3 лактации,кг 228,6±5,36 26,28 223,6±9,83 40,56 237,7±15,05 39,82 0,74
Удой пожизненный, кг 38374,2±1825,04 8940,87 40270,7±2973,30 12259,25 38115,2±4122,13 10906,13 0,86
Жир пожизненный, кг 1762,8±66,13 324,00 1782,9±107,88 444,81 1725,8±182,17 481,98 0,91
Белок пожизненный, кг 1374,1±51,36 251,62 1377,2±85,03 350,62 1342,6±140,89 372,76 0,85
Живая масса при 1 лактации, кг 534,0±7,91 38,76 529,2±8,69 35,85 508,5±28,62 75,73 0,23
Живая масса при 3 лактации, кг 581,1±6,97 34,17 566,1±9,27 38,25 580,0±15,58 41,23 0,59
ООО Агропромышленная фирма «Луч»
Возраст в лактациях 5,3±0,32 1,22 6,5±0,23 1,24 6,0±0,55 1,22 0,07
Удой за 305 дней 1 лактации, кг 5498,2±447,08 1672,82 4993,4±287,33 1520,42 4612,6±423,48 946,95 0,21
Удой за 305 дней 3 лактации, кг 7267,2±343,85 1286,60 7369,9±265,16 1427,94 7782,4±499,42 1116,73 0,52
Жир за 305 дней 1 лактации, % 3,64±0,133 0,50 3,86±0,063 0,33 3,64±0,150 0,33 0,47
Жир за 305 дней 3 лактации, % 3,66±0,083 0,31 3,83±0,081 0,44 3,64±0,120 0,27 0,62
Жир за 305 дней 1 лактации, кг 200,0±18,19 68,09 191,4±10,71 56,68 166,1±11,89 26,59 0,31
Жир за 305 дней 3 лактации, кг 267,0±15,71 58,77 280,9±11,06 59,58 281,6±10,30 23,04 0,49
Белок за 305 дней 1 лактации, % 3,18±0,059 0,22 3,05±0,042 0,22 3,13±0,105 0,23 0,32
Белок за 305 дней 3 лактации, % 3,12±0,076 0,28 3,16±0,050 0,27 3,01±0,135 0,30 0,72
Белок за 305 дней 1 лактации,кг 176,8±16,25 60,82 153,8±10,04 53,12 145,8±18,05 40,37 0,18
Белок за 305 дней 3 лактации,кг 225,5±10,06 37,65 233,7±9,81 52,86 231,9±6,74 15,08 0,67
Удой пожизненный, кг 37255,1±1694,86 6341,60 43560,2±1588,73 8555,58 43067,8±3488,03 7799,47 0,04
Жир пожизненный, кг 1759,4±82,47 308,56 1997,5±61,70 332,28 1999,2±121,78 272,31 0,05
Белок пожизненный, кг 1412,2±65,98 246,87 1585,2±48,15 259,28 1586,8±81,13 181,42 0,06
Живая масса при 1 лактации, кг 502,1±8,32 31,12 502,2±8,83 47,58 499,8±12,03 26,90 0,94
Живая масса при 3 лактации, кг 583,0±11,59 43,37 551,3±9,08 48,90 579,4±18,58 41,54 0,34

Влияние генотипов гена LEP (таблица 6, рисунки 32 – 37). ООО «Новопышминское». Генотип АА – удой за 305 дней 3 лактации (+633,5 кг к АВ и +1154,8 кг к ВВ); массовая доля жира 1 лактации (+0,14% к АВ и +0,07% к ВВ); массовая доля жира 3 лактации (+0,03% к АВ и 0,21% к ВВ); массовая доля белка 3 лактации (+0,04% к АВ и 0,03% к ВВ); выход молочного жира по 1 лактации (+12,5 кг к генотипу АВ и +30,1 кг к ВВ), выход молочного жира по 3 лактации (+27,8 кг к генотипу АВ и +65,0 кг к ВВ), выход молочного белка по 1 лактации (+3,5 кг к генотипу АВ и +21,6 кг к ВВ), выход молочного белка по 3 лактации (+18,1 кг к АВ и +35,3 кг к ВВ). Генотип АВ – удой за 305 дней 1 лактации (+1250,6 кг к генотипу АА), пожизненные показатели: удой (+1896,6 кг к АА и +2787,3 кг к ВВ), жир (+58,2 кг к АА и + 146,7 кг к ВВ), белок (+56,3 кг к АА и +115,7 кг к ВВ). ООО «Бородулинское». Генотип АА – удой за 305 дней 1 лактации (+122,6 кг к АВ и +474,0 кг к ВВ); массовая доля жира 3 лактации (+0,09% к АВ и +0,02% к ВВ); выход молочного жира по 1 лактации (+3,73 кг к АВ и +12,4 кг к ВВ); выход молочного белка по 1 лактации (+3,0 кг к АВ и 12,6 кг к ВВ); пожизненные показатели: удой (+2928,3 кг к АВ и +7727,7 кг к ВВ), жир (+162,4 кг к АВ и + 308,3 кг к ВВ), белок (+113,9 кг к АВ и +233,4 кг к ВВ). Генотип ВВ – удой за 305 дней 3 лактации (+571,8 кг к АА и +270,4 кг к АВ); массовая доля жира 1 лактации (+0,12% к АА и +0,09% к АВ); массовая доля белка 1 лактации (+0,12% к АА и +0,09% к АВ); массовая доля белка 3 лактации (+0,05% к АВ); выход молочного жира 3 лактации (+22,0 кг к АА и +16,4 кг к АВ); выход молочного белка 3 лактации (+19,1 кг к АА и +13,5 кг к АВ). ОАО «Учхоз «Уралец». Генотип АА – удой за 305 дней 3 лактации (+654,8 кг к генотипу АВ и +380,9 кг к ВВ); выход молочного жира 3 лактации (+27,3 кг к АВ и +16,8 кг к ВВ); выход молочного белка 3 лактации (+21,3 кг к АВ и +10,1 кг к ВВ); пожизненный выход молочного белка (+131,6 кг к ВВ). Генотип АВ – удой за 305 дней 1 лактации (+439,4 кг к АА и +244,2 кг ВВ); выход молочного жира 1 лактации (+17,6 кг к АА и +9,6 кг к ВВ); выход молочного белка 1 лактации (+13,7 кг к АА и +6,0 кг к ВВ); пожизненный удой (+701,9 кг к АА и +5328,6 кг к ВВ); пожизненный выход молочного жира (+167,4 кг к ВВ). Генотип ВВ – массовая доля белка 1 и 3 лактациям (+0,03% к АА и АВ). ООО Агропромышленная фирма «Луч». Генотип АА – удой за 305 дней 1 лактации (+265,0 кг к АВ и +627,5 кг к ВВ); массовая доля жира 3 лактация (+0,32% к АВ и +0,38% к ВВ); выход молочного жира 3 лактации (+4,8 кг к АВ и +35,7 кг к ВВ); пожизненные показатели: удой (+9434,6 кг к АВ и +7074,9 кг к ВВ); жир (+357,5 кг к АВ и +111,2 кг к ВВ); белок (+242,7 кг к АВ и +54,7 кг к ВВ). Генотип АВ – удой за 305 дней 3 лактации (+449,4 кг к АА и 696,3 кг к ВВ); массовая доля белка 1 лактации (+0,44% к АА и +0,10% к ВВ); массовая доля белка 3 лактации (+0,05% к АА и +0,15% к ВВ); выход молочного жира 1 лактации (+4,2 кг к АА и +30,9 кг к ВВ); выход молочного белка 1 лактации (+16,6 кг к АА и ВВ). Генотип ВВ – массовая доля жира 1 лактации (+0,37% к АА и +0,06% к АВ).

word image 25 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 32– Разница в показателе удоя в группах животных с разными генотипами гена LEP

word image 26 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 33– Разница в показателе МД жиро- и белковомолочности в группах животных с разными генотипами гена LEP

word image 27 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 34– Разница в показателе абсолютной жиро- и белковомолочности в группах животных с разными генотипами гена LEP

word image 28 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 35– Разница в показателе пожизненной продуктивности в группах животных с разными генотипами гена LEP

word image 29 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 36– Разница в показателе пожизненной продуктивности по жиру и белку в группах животных с разными генотипами гена LEP

word image 30 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 37– Разница в показателе живой массы в группах животных с разными генотипами гена LEP

Таблица 6 – Взаимосвязь генотипов гена LEP с продуктивностью коров в разрезе сельскохозяйственных организаций

Показатель AA AB BB p-значение
Mean ± se sd Mean ± se sd Mean ± se sd
1 2 3 4 5 6 7 8
ООО «Новопышминское»
Возраст в лактациях 5,1±0,261 0,78 5,5±0,12 0,68 5,6±0,26 0,74 0,13
Удой за 305 дней 1 лактации, кг 8669,6±487,14 1461,43 8685,9±235,54 1311,42 8101,3±481,18 1360,99 0,41
Удой за 305 дней 3 лактации, кг 11133,4±666,56 1999,70 10499,9±255,54 1422,83 9978,6±351,64 994,59 0,11
Жир за 305 дней 1 лактации, % 4,02±0,143 0,43 3,89±0,049 0,27 3,95±0,080 0,22 0,60
Жир за 305 дней 3 лактации, % 3,87±0,072 0,22 3,84±0,041 0,23 3,66±0,050 0,14 0,06
Жир за 305 дней 1 лактации, кг 350,5±26,51 79,55 338,0±10,76 59,93 320,5±20,61 58,31 0,33
Жир за 305 дней 3 лактации, кг 429,8±26,05 78,16 402,1±9,60 53,45 364,8±13,92 39,39 0,02
Белок за 305 дней 1 лактации, % 3,24±0,041 0,12 3,20±0,028 0,15 3,21±0,039 0,11 0,60
Белок за 305 дней 3 лактации, % 3,13±0,039 0,12 3,14±0,024 0,13 3,13±0,059 0,17 0,98
Белок за 305 дней 1 лактации,кг 281,7±17,80 53,41 278,1±8,09 45,05 260,1±16,19 45,81 0,35
Белок за 305 дней 3 лактации,кг 347,9±20,69 62,07 329,8±8,24 45,89 312,6±14,49 40,99 0,14
Удой пожизненный, кг 55446,4±1887,11 5661,33 56697,0±1512,36 8420,44 53909,7±2134,47 6037,21 0,71
Жир пожизненный, кг 2250,2±81,59 244,79 2308,37±59,577 331,71 2161,6±66,23 187,34 0,58
Белок пожизненный, кг 1828,4±69,88 209,66 1884,6±49,55 275,90 1769,0±51,87 146,73 0,66
ООО «Бородулинское»
Возраст в лактациях 6,0±0,47 1,49 5,8±0,32 1,50 5,3±0,17 0,70 0,18
Удой за 305 дней 1 лактации, кг 7163,8±241,09 762,42 7041,1±141,670 649,21 6689,8±308,09 1270,31 0,18
Удой за 305 дней 3 лактации, кг 8344,3±302,60 956,90 8645,76±316,242 1449,20 8916,1±300,91 1240,67 0,26
Жир за 305 дней 1 лактации, % 4,14±0,055 0,17 4,18±0,027 0,12 4,26±0,018 0,07 0,01

Продолжение таблицы 6

1 2 3 4 5 6 7 8
Жир за 305 дней 3 лактации, % 4,16±0,051 0,16 4,07±0,036 0,16 4,13±0,034 0,14 0,92
Жир за 305 дней 1 лактации, кг 297,6±13,01 41,14 293,8±5,93 27,17 285,1±13,09 53,99 0,42
Жир за 305 дней 3 лактации, кг 346,2±11,08 35,06 351,8±13,25 60,72 368,2±12,04 49,64 0,26
Белок за 305 дней 1 лактации, % 3,14±0,034 0,11 3,16±0,015 0,07 3,18±0,008 0,03 0,14
Белок за 305 дней 3 лактации, % 3,16±0,022 0,07 3,12±0,021 0,10 3,17±0,021 0,09 0,52
Белок за 305 дней 1 лактации, кг 225,7±9,28 29,35 222,7±4,47 20,50 213,1±9,80 40,41 0,27
Белок за 305 дней 3 лактации, кг 263,7±9,24 29,22 269,4±9,51 43,58 282,8±9,74 40,17 0,20
Удой пожизненный, кг 46128,6±3521,83 11137,01 43200,3±2349,89 10768,58 38400,8±1587,90 6547,10 0,04
Жир пожизненный, кг 2094,3±145,81 461,10 1931,8±104,62 479,44 1785,9±99,40 409,84 0,09
Белок пожизненный, кг 1607,3±109,46 346,14 1493,3±78,90 361,57 1373,9±79,28 326,89 0,09
Живая масса при 1 лактации, кг 597,0±21,32 67,43 587,0±8,48 38,90 632,1±7,05 29,10 0,02
Живая масса при 3 лактации, кг 654,8±14,56 46,04 633,0±9,21 42,22 654,7±7,11 29,31 0,75
ОАО «Учхоз «Уралец»
Возраст в лактациях 5,6±0,34 1,07 5,7±0,31 1,48 4,8±0,40 1,55 0,16
Удой за 305 дней 1 лактации, кг 5534,3±227,34 718,94 5973,7±130,06 623,74 5729,4±163,79 634,39 0,63
Удой за 305 дней 3 лактации, кг 7739,0±389,81 1232,71 7084,2±195,13 935,84 7358,1±224,33 868,84 0,48
Жир за 305 дней 1 лактации, % 4,00±0,050 0,16 4,00±0,023 0,11 4,01±0,028 0,11 0,94
Жир за 305 дней 3 лактации, % 3,99±0,046 0,14 3,99±0,027 0,13 3,98±0,040 0,15 0,82
Жир за 305 дней 1 лактации, кг 221,3±8,78 27,79 238,8±5,26 25,23 229,3±5,92 22,94 0,61
Жир за 305 дней 3 лактации, кг 310,0±18,08 57,17 282,7±7,89 37,87 293,2±10,00 38,73 0,46
Белок за 305 дней 1 лактации, % 3,09±0,034 0,11 3,1±0,02 0,10 3,12±0,028 0,11 0,41
Белок за 305 дней 3 лактации, % 3,12±0,031 0,10 3,1±0,02 0,09 3,14±0,031 0,12 0,46
Белок за 305 дней 1 лактации, кг 170,7±7,23 22,87 184,4±3,88 18,61 178,4±4,967 19,24 0,48
Белок за 305 дней 3 лактации, кг 241,5±13,15 41,60 220,2±6,28 30,14 231,5±8,08 31,32 0,62

Продолжение таблицы 6

1 2 3 4 5 6 7 8
Удой пожизненный, кг 40117,6±2478,97 7839,21 40819,6±2206,58 10582,43 35491,0±2852,79 11048,83 0,21
Жир пожизненный, кг 1809,1±93,34 295,17 1818,9±85,25 408,85 1651,6±103,49 400,82 0,27
Белок пожизненный, кг 1413,1±72,56 229,48 1410,3±67,06 321,65 1281,45±79,875 309,35 0,24
Живая масса при 1 лактации, кг 539,1±14,90 47,13 525,4±8,76 42,03 526,4±12,49 48,40 0,54
Живая масса при 3 лактации, кг 599,0±10,48 33,15 568,3±7,417 35,57 571,2±9,29 36,00 0,10
ООО Агропромышленная фирма «Луч»
Возраст в лактациях 7,0±1,00 1,41 5,7±0,18 0,65 6,2±0,24 1,45 0,79
Удой за 305 дней 1 лактации, кг 5611,5±1672,50 2365,27 5346,5±357,81 1239,50 4984,0±278,51 1599,95 0,40
Удой за 305 дней 3 лактации, кг 7445,5±227,50 321,73 7894,9±248,63 861,29 7198,5±253,35 1477,28 0,22
Жир за 305 дней 1 лактации, % 3,43±0,220 0,31 3,74±0,105 0,37 3,80±0,072 0,41 0,27
Жир за 305 дней 3 лактации, % 4,11±1,110 1,57 3,79±0,066 0,23 3,73±0,059 0,34 0,25
Жир за 305 дней 1 лактации, кг 196,1±69,85 98,78 200,3±15,19 52,65 187,7±10,31 59,27 0,57
Жир за 305 дней 3 лактации, кг 303,4±73,15 103,45 298,6±9,75 33,77 267,7±10,13 59,08 0,09
Белок за 305 дней 1 лактации, % 2,75±0,080 0,11 3,19±0,064 0,22 3,09±0,037 0,21 0,74
Белок за 305 дней 3 лактации, % 3,19±0,190 0,27 3,24±0,090 0,31 3,09±0,045 0,26 0,15
Белок за 305 дней 1 лактации, кг 155,6±50,40 71,28 172,2±13,84 47,95 155,5±9,92 57,01 0,53
Белок за 305 дней 3 лактации, кг 237,0±7,00 9,90 255,7±10,27 35,61 222,2±8,13 47,41 0,07
Удой пожизненный, кг 49040,0±2403,00 3398,36 39605,4±2142,58 7422,14 41965,1±1469,13 8566,46 0,88
Жир пожизненный, кг 2096,4±401,70 568,09 1738,9±70,23 243,31 1985,2±56,78 331,14 0,21
Белок пожизненный, кг 1634,3±268,05 379,08 1391,6±59,54 206,27 1579,6±43,85 255,74 0,18
Живая масса при 1 лактации, кг 502,5±32,50 45,96 502,5±6,35 21,99 501,7±7,98 46,53 0,95
Живая масса при 3 лактации, кг 515,0±15,00 21,21 586,2±9,77 33,85 558,3±8,67 50,54 0,67

Влияние генотипов гена LGB (таблица 7, рисунки 38 – 43). ООО «Новопышминское». Генотип АА – удой за 305 дней 1 лактации (+232,6 кг к ВВ); массовая доля жира 3 лактации (+0,17% к АВ и +0,20% к ВВ); массовая доля белка 3 лактации (+0,05% к АВ и +0,06% к ВВ); пожизненные показатели: удой (+81,5 кг к АВ и +1496,6 кг к ВВ); жир (+52,0 кг к АВ и +155,6 кг к ВВ); белок (+20,0 кг к АВ и +129,2 кг к ВВ). Генотип АВ – удой за 305 дней 3 лактации (+831,5 кг к АА и +442,0 кг к ВВ); массовая доля жира 1 лактации (+0,05% к АА и +0,06% к ВВ); массовая доля белка 1 лактации (+0,03% к АА и +0,05% к ВВ); выход молочного жира 1 лактации (+3,7 кг к АА и +13,9 кг к ВВ); выход молочного жира 3 лактации (+15,7 кг к АА и +19,1 кг к ВВ); выход молочного белка 1 лактации (+1,9 кг к АА и +10,9 кг к ВВ); выход молочного белка 3 лактации (+20,8 кг к АА и +14,7 кг к ВВ). ООО «Бородулинское». Генотип АА – удой за 305 дней 1 лактации (+441,5 кг к АВ и +398,6 кг к ВВ); удой за 305 дней 3 лактации (+147,6 кг к ВВ); массовая доля жира 1 лактации (+0,04% к АВ и +0,06% к ВВ); массовая доля жира 3 лактации (+0,06% к АВ и 0,03% к ВВ); массовая доля белка 1 лактации (+0,02% к АВ); массовая доля белка 3 лактации (+0,10% к АВ и +0,09% к ВВ); выход молочного жира 1 лактации (+21,9 кг к АВ и +21,6 кг к ВВ); выход молочного жира 3 лактации (+4,8 кг к АВ и +8,0 кг к ВВ); выход молочного белка 1 лактации (+15,5 кг к АВ и +12,5 кг к ВВ); выход молочного белка 3 лактации (+8,1 кг к АВ и +11,9 кг к ВВ); пожизненный выход молочного жира (+175,1 кг к АВ и +187,4 кг к ВВ); пожизненный выход молочного белка (+151,2 кг к АВ и +147,6 кг к ВВ). Генотип АВ – пожизненный удой (+747,7 кг к АА и +847,4 кг к ВВ). ОАО «Учхоз «Уралец». Генотип АА – удой за 305 дней 1 лактации (+70,4 кг к АВ и +246,3 кг к ВВ); выход молочного жира 1 лактации (+5,2 кг к ВВ); выход молочного белка 1 лактации (+4,9 кг к ВВ). Генотип АВ – массовая доля жира 3 лактации (+0,07% к АА и ВВ); массовая доля белка 3 лактации (+0,04% к АА и +0,05% к ВВ); пожизненный удой (+179,5 кг к АА и +7798,0 кг к ВВ); пожизненный выход молочного жира (+5,5 кг к АА и +275,1 кг ВВ); пожизненный выход молочного белка (+1,5 к АА и +221,6 к ВВ). Генотип ВВ – удой за 305 дней 3 лактации (+100,7 кг к АА и +241,3 кг к ВВ); массовая доля жира 1 лактации (+0,10% к АА и +0,06% к АВ); массовая доля белка 1 лактации (+0,05% к АА и АВ); выход молочного жира 3 лактации (+4,0 кг к АА и +4,3 кг к АВ); выход молочного белка 3 лактации (+2,4 кг к АА и +3,5 кг к АВ). ООО Агропромышленная фирма «Луч». Генотип АА – удой за 305 дней 1 лактации (+720,3 кг к АВ и +836,1 кг к ВВ); удой за 305 дней 3 лактации (+317,4 кг к АВ и +194,8 кг к ВВ); массовая доля жира 1 лактации (+0,01% к АВ и +0,16% к ВВ); массовая доля жира 3 лактации (+0,03% к АВ и +0,14% к ВВ); массовая доля белка 1 лактации (+0,16% к АВ и +0,14% к ВВ); массовая доля белка 3 лактации (+0,15% к АВ и +0,03% к ВВ); выход молочного жира 1 лактации (+25,6 кг к АВ и +41,2 кг к ВВ); выход молочного жира 3 лактации (+16,8 кг к АВ и +17,1 кг к ВВ); выход молочного белка 1 лактации (+33,1 кг к АВ и +35,3 кг к ВВ); выход молочного белка 3 лактации (+21,1 кг к АВ и +8,3 кг к ВВ). Генотип ВВ – пожизненный удой (+5460,6 кг к АА и +3197,3 кг к АВ); пожизненный выход молочного жира (+185,9 кг к АА и +218,8 кг к АВ); пожизненный выход молочного белка (+148,7 кг к АА и +182,3 кг к АВ).

word image 31 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 38– Разница в показателе удоя в группах животных с разными генотипами гена LGB

word image 32 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 39– Разница в показателе МД жиро- и белковомолочности в группах животных с разными генотипами гена LGB

word image 33 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 40– Разница в показателе абсолютной жиро- и белковомолочности в группах животных с разными генотипами гена LGB

word image 34 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 41– Разница в показателе пожизненной продуктивности в группах животных с разными генотипами гена LGB

word image 35 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 42– Разница в показателе пожизненной продуктивности по жиру и белку в группах животных с разными генотипами гена LGB

word image 36 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 43. Разница в показателе живой массы в группах животных с разными генотипами гена LGB

Таблица 7 – Взаимосвязь генотипов гена LGB с продуктивностью коров в разрезе сельскохозяйственных организаций

Показатель AA AB BB p-значение
Mean ± se sd Mean ± se sd Mean ± se sd
1 2 3 4 5 6 7 8
ООО «Новопышминское»
Возраст в лактациях 5,5±0,15 0,52 5,4±0,14 0,78 5,4±0,29 0,79 0,82
Удой за 305 дней 1 лактации, кг 8638,5±264,78 917,25 8606,8±288,09 1551,45 8405,8±407,50 1078,15 0,75
Удой за 305 дней 3 лактации, кг 9972,7±416,41 1442,51 10804,1±266,11 1433,04 10362,1±670,67 1774,44 0,40
Жир за 305 дней 1 лактации, % 3,90±0,074 0,26 3,94±0,062 0,33 3,88±0,083 0,22 0,99
Жир за 305 дней 3 лактации, % 3,94±0,063 0,22 3,78±0,039 0,21 3,74±0,079 0,21 0,03
Жир за 305 дней 1 лактации, кг 336,7±12,61 43,71 340,4±13,63 73,41 326,5±17,61 46,60 0,80
Жир за 305 дней 3 лактации, кг 392,1±15,16 52,52 407,7±10,56 56,91 388,7±30,49 80,67 0,94
Белок за 305 дней 1 лактации, % 3,19±0,041 0,14 3,23±0,028 0,15 3,17±0,034 0,09 0,95
Белок за 305 дней 3 лактации, % 3,18±0,038 0,13 3,13±0,026 0,14 3,11±0,041 0,11 0,26
Белок за 305 дней 1 лактации,кг 275,9±9,54 33,05 277,9±9,944 53,55 267,0±13,71 36,27 0,76
Белок за 305 дней 3 лактации,кг 316,8±13,32 46,15 337,7±8,72 46,95 323,0±22,77 60,25 0,60
Удой пожизненный, кг 56280,1±1667,29 5775,68 56198,5±1602,66 8630,63 54683,4±2312,53 6118,39 0,70
Жир пожизненный, кг 2327,1±82,88 287,11 2275,1±60,32 324,87 2171,5±68,91 182,32 0,29
Белок пожизненный, кг 1885,8±66,17 229,25 1865,7±49,92 268,85 1756,6±68,04 180,03 0,32
ООО «Бородулинское»
Возраст в лактациях 5,7±0,36 1,04 5,6±0,26 1,43 5,8±0,32 1,03 0,91
Удой за 305 дней 1 лактации, кг 7301,2±390,02 1103,15 6859,8±178,34 976,84 6902,6±205,97 651,34 0,42
Удой за 305 дней 3 лактации, кг 8713,3±512,17 1448,66 8707,1±246,49 1350,11 8565,8±320,74 1014,29 0,80
Жир за 305 дней 1 лактации, % 4,24±0,033 0,09 4,20±0,026 0,14 4,18±0,038 0,12 0,31

Продолжение таблицы 7

1 2 3 4 5 6 7 8
Жир за 305 дней 3 лактации, % 4,15±0,038 0,11 4,09±0,031 0,17 4,12±0,047 0,15 0,73
Жир за 305 дней 1 лактации, кг 309,7±17,19 48,63 287,8±7,65 41,93 288,1±8,88 28,09 0,30
Жир за 305 дней 3 лактации, кг 361,1±19,15 54,17 356,3±10,17 55,71 353,1±13,84 43,78 0,75
Белок за 305 дней 1 лактации, % 3,18±0,011 0,03 3,16±0,015 0,08 3,18±0,018 0,06 0,83
Белок за 305 дней 3 лактации, % 3,23±0,033 0,09 3,13±0,016 0,09 3,14±0,024 0,07 0,05
Белок за 305 дней 1 лактации,кг 232,2±12,63 35,74 216,7±5,79 31,75 219,7±6,58 20,81 0,44
Белок за 305 дней 3 лактации,кг 280,5±15,21 43,04 272,4±7,68 42,09 268,5±10,16 32,14 0,54
Удой пожизненный, кг 41664,0±3200,57 9052,60 42411,7±1926,86 10553,88 41564,3±2849,21 9009,99 0,96
Жир пожизненный, кг 2062,5±172,15 486,92 1887,4±87,65 480,13 1875,1±117,91 372,86 0,42
Белок пожизненный, кг 1600,0±130,91 370,30 1448,8±67,58 370,16 1452,3±86,575 273,77 0,41
Живая масса при 1 лактации, кг 629,3±17,53 49,60 605,2±7,64 41,85 584,9±17,58 55,60 0,05
Живая масса при 3 лактации, кг 656,5±10,48 29,66 642,3±7,70 42,19 644,9±12,91 40,85 0,58
ОАО «Учхоз «Уралец»
Возраст в лактациях 5,5±0,44 1,65 5,6±0,28 1,47 4,7±0,28 0,76 0,37
Удой за 305 дней 1 лактации, кг 5884,0±182,57 683,11 5813,5±131,73 684,51 5619,7±203,52 538,48 0,42
Удой за 305 дней 3 лактации, кг 7370,5±249,35 933,02 7230,0±205,22 1066,37 7471,2±354,27 937,33 0,96
Жир за 305 дней 1 лактации, % 3,97±0,024 0,09 4,00±0,024 0,13 4,07±0,047 0,12 0,09
Жир за 305 дней 3 лактации, % 3,95±0,036 0,14 4,02±0,022 0,12 3,95±0,077 0,20 0,58
Жир за 305 дней 1 лактации, кг 233,5±6,97 26,10 232,6±5,23 27,22 228,2±7,57 20,05 0,69
Жир за 305 дней 3 лактации, кг 291,2±11,04 41,31 291,0±8,88 46,16 295,2±15,07 39,88 0,87
Белок за 305 дней 1 лактации, % 3,09±0,016 0,06 3,09±0,021 0,11 3,14±0,056 0,15 0,31
Белок за 305 дней 3 лактации, % 3,10±0,030 0,11 3,14±0,018 0,10 3,09±0,032 0,09 0,80
Белок за 305 дней 1 лактации,кг 181,3±5,44 20,39 179,6±3,96 20,58 176,49±7,42 19,65 0,61
Белок за 305 дней 3 лактации,кг 228,4±8,58 32,11 227,3±6,96 36,17 230,8±11,12 29,44 0,92

Продолжение таблицы 7

1 2 3 4 5 6 7 8
Удой пожизненный, кг 40018,2±3116,13 11659,52 40197,7±1948,81 10126,32 32399,7±2223,51 5882,87 0,19
Жир пожизненный, кг 1800,7±105,18 393,56 1806,3±79,05 410,79 1531,2±58,30 154,25 0,22
Белок пожизненный, кг 1401,9±81,50 304,97 1403,3±62,04 322,39 1181,7±37,63 99,57 0,19
Живая масса при 1 лактации, кг 514,5±10,42 39,02 533,5±9,63 50,08 537,5±9,78 25,90 0,19
Живая масса при 3 лактации, кг 576,7±8,73 32,69 577,1±8,24 42,85 567,4±3,98 10,55 0,66
ООО Агропромышленная фирма «Луч»
Возраст в лактациях 6,0±0,40 1,34 6,0±0,24 1,29 6,3±0,44 1,42 0,61
Удой за 305 дней 1 лактации, кг 5695,0±634,29 2005,80 4974,6±250,70 1302,68 4858,9±485,69 1535,89 0,22
Удой за 305 дней 3 лактации, кг 7602,0±505,94 1678,02 7284,7±251,20 1305,28 7407,3±354,95 1122,47 0,73
Жир за 305 дней 1 лактации, % 3,81±0,123 0,39 3,80±0,071 0,37 3,64±0,154 0,49 0,37
Жир за 305 дней 3 лактации, % 3,80±0,099 0,33 3,77±0,084 0,44 3,68±0,110 0,35 0,48
Жир за 305 дней 1 лактации, кг 214,7±23,11 73,07 189,1±10,43 54,24 173,5±15,19 48,03 0,11
Жир за 305 дней 3 лактации, кг 289,9±21,74 72,13 273,1±9,95 51,71 272,8±16,47 52,08 0,48
Белок за 305 дней 1 лактации, % 3,22±0,089 0,28 3,06±0,041 0,21 3,08±0,054 0,17 0,16
Белок за 305 дней 3 лактации, % 3,22±0,081 0,27 3,08±0,052 0,27 3,19±0,094 0,30 0,75
Белок за 305 дней 1 лактации,кг 186,3±23,32 73,75 153,2±8,67 45,05 151,0±17,04 53,91 0,15
Белок за 305 дней 3 лактации,кг 244,7±16,83 55,85 223,7±8,11 42,18 236,5±13,72 43,39 0,65
Удой пожизненный, кг 39259,1±1834,31 6083,70 41522,5±1587,95 8251,26 44719,8±3169,52 10022,90 0,13
Жир пожизненный, кг 1908,1±99,00 328,35 1875,1±58,11 302,00 2093,9±124,03 392,24 0,22
Белок пожизненный, кг 1522,8±85,78 284,53 1489,2±44,72 232,41 1671,5±84,69 267,83 0,21
Живая масса при 1 лактации, кг 493,9±12,84 42,61 504,8±7,23 37,59 502,8±16,00 50,61 0,61
Живая масса при 3 лактации, кг 571,7±16,53 54,85 563,3±8,88 46,15 554,9±15,72 49,71 0,43

6. ДУПЛЕТНОЕ ВЛИЯНИЕ ГЕНОВ

С помощью линейной регрессии мы провели многофакторный анализ с целью определения благоприятных генотипов пары генов. Мы сосредоточились на трёх парах CSN_AB-GHR, CSN_AB-LEP и GHR-LEP; по причине того, что только для этих генов было показано значимое влияние на фенотип. В соответствии с предположением о синергичном влияние генов можно ожидать, что в паре CSN_AB-GHR предпочтительным будет генотип XB-BB (на месте X может быть любой аллель), для пары CSN_AB-LEP – XB-AX и для пары GHR-LEP – BB-AX.

В паре CSN_AB-GHR в результате наименьшие показатели удоя были выявлены у генотипов AA-AA и AA-AB, а присутствие в генотипе или гомозиготной формы BB по GHR или гетерозиготности/гомозиготности гена каппа-казеина с аллелем B увеличивает удой (рисунок 44) и выход белка и жира (приложение 1 и 2).

word image 37 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 44 – Изменение удоя в зависимости от генотипа по паре генов CSN_AB-GHR. Числа над каждым отдельным боксплотом – процент данного генотипа в исследуемом поголовье. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

На рисунке 45 можно видеть график, на котором отражено влияние на удой пары генов CSN_AB-LEP. В соответствии с гипотезой генотип AA-BB менее предпочтителен в связи с уменьшенным выходом молока, но в то же время он является наиболее распространённым в популяции. Можно так же предположить кумулятивный характер влияния этик генов. Так генотип AA-BB (рецессивная гомозигота) имеет наиболее низкие показатели, особи с генотипом AB-AB (с одним доминантным аллелем по каждому гену) – наиболее высокие, а особи с генотипом AA-AB, промежуточные.

word image 38 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 45 – Изменение удоя в зависимости от генотипа по паре генов CSN_AB-LEP. Числа над каждым отдельным боксплотом – процент данного генотипа в исследуемом поголовье. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

Для генотипов AX-AX пары GHR-LEP, на рисунке 46, наблюдается однородность в показателях удоя, а для варианта BB-AA, значение выше (наибольшие средние). Данные находятся в соответствии с гипотезой о синергичном воздействии генов. Интересно отметить генотипы AA-BB и AA-AB показавшие наименьший удой за первую лактацию, но при этом особи с генотипом AA-AB сохраняют эту тенденцию и в третью, в то время как наименее предпочтительный вариант AA-BB (содержащий аллели пониженной продуктивности) почти не отличается от других аллельных вариантов.

word image 39 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 46 – Изменение удоя в зависимости от генотипа по паре генов GHR-LEP. Числа над каждым отдельным боксплотом – процент данного генотипа в исследуемом поголовье. Горизонтальные чёрные линии – медианы, белые пунктирные линии – средние значения, чёрные точки – выбросы.

Внутри организаций доли конкретных генотипов распределены неоднородно (таблица 8). Максимумы долей предпочтительных генотипов, среди всех хозяйств, обнаружились в ООО «Новопышминское», в котором частота генотипа XB-BB пары CSN_AB-GHR составляет 21%, частота высокопродуктивного генотипа XB-AX пары CSN_AB-LEP 50%, а процент желательного генотипа BB-AX по генам GHR-LEP – 35%. В OOO «Бородулинское» большая представленность, относительно всех желательных генотипов, наблюдается для пары CSN_AB-LEP и составляет 27%. Для остальных хозяйств генотипы ассоциированные с высокими показателями удоя составляют не многим более десятой части от всех генотипов.

Таблица 8 – Распределение долей пар генотипов по исследованным хозяйствам. (Серым выделены генотипы с наиболее высокими показателями продуктивности)

Генотип CSN_AB-GHR
AA-AA AA-AB AA-BB AB-AA AB-AB AB-BB BB-AA BB-AB BB-BB
1 2 3 4 5 6 7 8 9
ООО «Новопышминское»
12,5 10,4 20,8 14,6 10,4 18,8 4,2 6,2 2,1
OOO «Бородулинское»
33,3 20,8 10,4 12,5 18,8 4,2

Продолжение таблицы 8

1 2 3 4 5 6 7 8 9
ООО “Агропромышленная фирма “Луч””
27,1 47,9 8,3 2,1 6,2 2,1 6,2
ОАО “Учхоз Уралец”
41,7 31,2 14,6 8,3 4,2
Генотип CSN_AB-LEP
AA-AA AA-AB AA-BB AB-AA AB-AB AB-BB BB-AA BB-AB BB-BB
ООО “Новопышминское”
8,3 25,0 10,4 6,2 31,2 6,2 4,2 8,3
OOO “Бородулинское”
8,3 29,2 27,1 12,5 14,6 4,2 4,2
ООО “Агропромышленная фирма “Луч””
14,6 68,8 8,3 2,1 4,2 2,1
ОАО “Учхоз Уралец”
18,8 37,5 31,2 2,1 10,4
Генотип GHR-LEP
AA-AA AA-AB AA-BB AB-AA AB-AB AB-BB BB-AA BB-AB BB-BB
ООО “Новопышминское”
8,3 14,6 8,3 4,2 20,8 2,1 6,2 29,2 6,2
OOO “Бородулинское”
10,4 20,8 18,8 10,4 18,8 10,4 4,2 6,2
ООО “Агропромышленная фирма “Луч””
2,1 27,1 4,2 18,8 37,5 4,2 6,2
ОАО “Учхоз Уралец”
8,3 25,0 16,7 6,2 16,7 12,5 6,2 6,2 2,1

В то же время весьма значимым остаётся влияние среды, описанное в выше. На рисунках 47-49 показаны графики воздействия генотипов на удой в разных хозяйствах. В то время как средние по хозяйствам различаются, внутри хозяйств средние изменяются не значительно.

word image 40 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью word image 41 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 47.– Распределение значений удоя в хозяйствах в зависимости от генотипа CSN_AB-GHR. Сплошные линии – средние значения показателя, серые зоны – пределы вариабельности признака.

word image 42 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью word image 43 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 48– Распределение значений удоя в хозяйствах в зависимости от генотипа CSN_AB-LEP. Сплошные линии – средние значения показателя, серые зоны – пределы вариабельности признака.

word image 44 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью word image 45 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 49– Распределение значений удоя в хозяйствах в зависимости от генотипа GHR-LEP. Сплошные линии – средние значения показателя, серые зоны – пределы вариабельности признака.

Подобная же картина и в случае с живой массой, максимальные значения которой наблюдаются в OOO “Бородулинское”. Отметим, что внутри этого хозяйства наблюдается увеличение массы тела от менее предпочтительного генотипа к более предпочтительному, но в оставшихся хозяйствах картина противоположная (рисунок 50).

word image 46 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью word image 47 Фенотипирование и генотипирование популяции крупного рогатого скота Свердловской области по генам ассоциированным с продуктивностью

Рисунок 50– Парное взаимодействие генов каппа-казеина и лептина на живую массу

7. РАЗРАБОТКА ДНК-ЗОНДОВ ДЛЯ ГЕНОТИПИРОВАНИЯ ПО ГЕНАМ ЛЕПТИНА И РЕЦЕПТОРА СОМАТОТРОПИНА

Найденные нами ассоциации между генотипами и показателями продуктивности для генов каппа-казеина, лептина и рецептора гормона роста говорят о важности данных генов для хозяйств. Выявление коров с желательными генотипами способствовало бы улучшению продуктивных качеств поголовья и переходу к селекции, основанной не на линиях, но на генетических особенностях каждой особи. Однако генотипирование методом ПЦР-ПДРФ анализа достаточно трудозатратно и растянуто во времени в силу специфики методики. А технология ДНК-чипов слишком избыточна и дорогостояща. Имея в арсенале амплификатор для ПЦР в реальном времени, задача генотипирования, даже по однонуклеотидным полиморфизмам (ОНП), представляется возможной. Для гена лептина и рецептора соматотропина нам удалось создать тест систему для ПЦР-РВ на основе технологии TaqMan.

Тест система представляет собой пару праймеров и аллель-специфичные зонды с красителем на 5′-конце и гасителем на 3′-конце, для каждого гена (таблица 9).

Таблица 9 – Зонды и праймеры для генотипирования поголовья КРС по генам лептина (LEP) и рецептора соматотропина (GHR)

Ген LEP
Зонд 1 6-FAM-TCA TCC TGG ACC TTG CGG ATG GGC ACA-BHQ-1
Зонд 2 Cy5-TGT CAT CCT GGA CCT TGC AGA TGG GCA CA-BHQ-2
Праймер 1 GAT GGC CAC GGT TCT ACC TC
Праймер 2 GGC CCT ATC TGT CTT ACG TGG
Ген GHR
Зонд 1 6-FAM-CTT CAG CTG CCC AGT GTG CGG CAC CTT GA-BHQ-1
Зонд 2 Cy5-TCA GCT GCC CAG TGC GCG GCA CCT TGA-BHQ-2
Праймер 1 TCC AAT TAG GGC AGA AAG ACT GA
Праймер 2 GGA TAT GTA TAT GGG GCC TCG C

Реакционная смесь включает: 2,5 мкл буфера с MgCl2, 0,5 мкл dNTP, по 1,0 мкл прямого и обратного праймеров, 1,0 мкл каждого зонда, 0,3 Taq-полимеразы; 12,7 мкл воды для ПЦР и 5 мкл матрицы.

Разработка праймеров проводилась с помощью web-инструмента Primer3Plus [56].

Для отработки зондов были отобраны пробы ДНК коров, исследованных на биочипах и методом ПЦР-ПДРФ, по два генотипа с каждого исследования. Режим амплификации и результаты исследования в реальном времени (приложение 3, 4) полностью соответствовали полученным ранее результатам.

Предложенная методика позволяет сократить временные затраты с двух рабочих дней до 3-4 часов, без использования канцерогенных веществ и с более простой компьютерной интерпретацией результатов.

ЗАКЛЮЧЕНИЕ

Проведенная оценка зоотехнических показателей молочной продуктивности выявила значительную разницу между хозяйствами, как средовым фактором, который существенно влияет на молочную продуктивность. За исключением возраста в лактациях и массовой доли белка по третьей лактации, все показатели были статистически значимо различны (P<0,05).

Геномная оценка маточного поголовья показала, что в целом наблюдается высокая доля гомозиготных особей с формой аллеля A по гену каппа-казеина. Гомозиготны по данному варианту гена CSN_AB 67% особей, а внутри хозяйств его частота может составлять до 86%. Подобное смещение в пользу доминантных гомозигот является следствием отбора на высокие показатели удоя, что мы можем понять по значимому отклонению наблюдаемых генотипов от ожидаемых. Значимые отклонения от ожидаемого распределения также наблюдаются для генов GHR и LGB. По гену GHR больше всего в популяции доминантных особей AA (41%), в то время как по гену LGB преобладают гетерозиготы AB (56%). Преобладающие генотипы гена лептина AB и гена DGAT1 AA с 47% и 45% соответственно. Отклонений от ожидаемого распределение частот аллелей и генотипов по генам DGAT1 и LEP не обнаружено.

При сопоставление фенотипических и генотипических признаков у исследуемой группы животных Ген DGAT1 значимо коррелировал (p<0,05) только с изменением двух исследуемых показателей: пожизненные содержания жира и белка.

Наибольший спектр влияния удалось определить для генов CSN_AB, LEP и GHR. Доминантный аллельный вариант B каппа-казеина значимо ассоциирован с повышением выхода молока.

Гомозиготный AA и гетерозиготный варианты по лептину, сходны с влиянием гена каппа-казеина, значимо повышают удой за 305 дней первой и третьей лактации. К тому же увеличивая долевые показатели жира.

Генотип BB рецептора гормона роста значимо увеличивает выход молока относительно вариантов с доминантным аллелем A.

По влиянию генов на живую массу удалось зафиксировать положительное влияние B аллеля каппа-казеина и A аллеля лептина.

Достоверного влияния генотипа на продуктивные характеристики не были показаны для гена бета-лактоглобулина.

Корреляционная зависимость установлена для дуплетного влияния генотипов AX-AX (где Х любая аллель) пары GHR-LEP в однородности показателя удоя, а для варианта BB-AA, значение выше (наибольшие средние), что соответствует гипотезе о синергичном воздействии генов.

Рекомендации для сельскохозяйственных организаций. По результатам полученных исследований по моновлиянию генов без учета паратипических условиях можно рекомендовать для селекционного отбора сельскохозяйственных организаций определенные генотипы. Средние данные по основным показателям в исследуемой группе: удой за 305 дней 1 лактации 6617,1 кг; удой за 305 дней 3 лактации 8474,9 кг; массовая доля жира 1 лактации 3,97%, массовая доля жира 3 лактации 3,92%; массовая доля белка 1 лактации 3,14%, массовая доля белка 3 лактации 3,13%.

Таблица 10 – Рекомендуемые генотипы для отбора в селекционной работе

Генотип Показатель Сре днее ± к среднему по группе Закупочная цена кг молока, руб. Дополни-тельная выручка, руб
1 2 3 4 5 6
CSN_AB
АВ удой за 305 дней 1 лактации, кг 7475,3 +858,2 24,50 21025,90
массовая доля жира 1 лактации, % 4,08 +0,11
массовая доля белка 1 лактации 3,16 +0,02

Продолжение таблицы 10

удой за 305 дней 3 лактации, кг 9032,5 +557,6 24,50 13661,20
массовая доля жира 3 лактации, % 3,87 -0,05
массовая доля белка 3 лактации 3,13 0
ВВ удой за 305 дней 1 лактации, кг 7452,0 +834,9 24,50 20455,05
массовая доля жира 1 лактации, % 3,87 -0,10
массовая доля белка 1 лактации 3,14 0
удой за 305 дней 3 лактации, кг 9418,4 +943,5 24,50 23115,75
массовая доля жира 3 лактации, % 4,03 +0,06
DGAT1
ВВ удой за 305 дней 1 лактации, кг 7184,0 +566,9 24,50 13889,05
массовая доля жира 1 лактации, % 3,94 -0,03
массовая доля белка 1 лактации 3,13 -0,01
удой за 305 дней 3 лактации, кг 8726,1 +251,2 24,50 6154,40
массовая доля жира 3 лактации, % 3,96 0,04
массовая доля белка 3 лактации 3,18 0,05
GHR
ВВ удой за 305 дней 1 лактации, кг 7475,3 +858,2 24,50 21025,90
массовая доля жира 1 лактации, % 3,94 -0,03
массовая доля белка 1 лактации 3,84 +0,70
удой за 305 дней 3 лактации, кг 9461,0 +986,1 24,50 24159,45
массовая доля жира 3 лактации, % 3,84 -0,08
массовая доля белка 3 лактации 3,10 -0,03
LEP
АА удой за 305 дней 1 лактации, кг 6975,1 +358,0 24,50 8771,00
массовая доля жира 1 лактации, % 4,02 +0,05
массовая доля белка 1 лактации 3,13 -0,01

Продолжение таблицы 10

удой за 305 дней 3 лактации, кг 8900,8 +425,9 24,50 10434,55
массовая доля жира 3 лактации, % 4,02 +0,04
массовая доля белка 3 лактации 3,14 +0,01
АВ удой за 305 дней 1 лактации, кг 7111,3 +494,2 24,50 12107,90
массовая доля жира 1 лактации, % 3,97 0
массовая доля белка 1 лактации 3,16 +0,02
удой за 305 дней 3 лактации, кг 8790,0 +315,1 24,50 7719,95
массовая доля жира 3 лактации, % 3,93 -0,04
массовая доля белка 3 лактации 3,14 +0,01
сочетанный вариант генов GHR-LEP
BB-АА удой за 305 дней 1 лактации, кг 6995,2 +378,1 24,50 9263,45
массовая доля жира 1 лактации, % 4,00 +0,03
массовая доля белка 1 лактации 3,20 +0,06
удой за 305 дней 3 лактации, кг 8976,2 +501,3 24,50 12281,85
массовая доля жира 3 лактации, % 3,79 -0,13
массовая доля белка 3 лактации 3,08 -0,05
BB-АВ удой за 305 дней 1 лактации, кг 7768,0 +1150,1 24,50 28177,45
массовая доля жира 1 лактации, % 3,92 -0,05
массовая доля белка 1 лактации 3,18 +0,04
удой за 305 дней 3 лактации, кг 9886,6 +1411,7 24,50 34586,65
массовая доля жира 3 лактации, % 3,82 -0,10
массовая доля белка 3 лактации 3,12 -0,01

Абсолютно все предложенные варианты, даже с отрицательной разницей в показателе, соответствуют требованиям, предъявляемым к качеству молока по массовой доле жира и белка при закупке молока перерабатывающими предприятиями.

В современных условиях при формировании высокопродуктивных стад, отбирая животных по конкретным генотипам, необходимо учитывать те средовые факторы, при которых генетический потенциал будет реализовываться полностью.

Рекомендации для молекулярно-генетических лабораторий. Для наиболее быстрого и дешевого генотипирования по генам GHR и LEP рекомендуем использовать разработанные в ходе проведения научно-исследовательской работы зонды для диагностики в режиме реального времени.

Список использованной литературы

Приложения

Автор НИР 

Оглавление

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *